ID: 1084267859

View in Genome Browser
Species Human (GRCh38)
Location 11:68014183-68014205
Sequence TTCCCCCTCATTAGACTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 113}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084267859_1084267866 -2 Left 1084267859 11:68014183-68014205 CCTCCCAGTCTAATGAGGGGGAA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1084267866 11:68014204-68014226 AAATAAGGGAGATGTGGACAGGG 0: 1
1: 0
2: 1
3: 31
4: 384
1084267859_1084267870 9 Left 1084267859 11:68014183-68014205 CCTCCCAGTCTAATGAGGGGGAA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1084267870 11:68014215-68014237 ATGTGGACAGGGTTGGGAGGTGG 0: 1
1: 0
2: 6
3: 79
4: 608
1084267859_1084267871 10 Left 1084267859 11:68014183-68014205 CCTCCCAGTCTAATGAGGGGGAA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1084267871 11:68014216-68014238 TGTGGACAGGGTTGGGAGGTGGG 0: 1
1: 0
2: 8
3: 62
4: 586
1084267859_1084267869 6 Left 1084267859 11:68014183-68014205 CCTCCCAGTCTAATGAGGGGGAA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1084267869 11:68014212-68014234 GAGATGTGGACAGGGTTGGGAGG 0: 1
1: 0
2: 3
3: 53
4: 501
1084267859_1084267868 3 Left 1084267859 11:68014183-68014205 CCTCCCAGTCTAATGAGGGGGAA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1084267868 11:68014209-68014231 AGGGAGATGTGGACAGGGTTGGG 0: 1
1: 0
2: 2
3: 75
4: 478
1084267859_1084267865 -3 Left 1084267859 11:68014183-68014205 CCTCCCAGTCTAATGAGGGGGAA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1084267865 11:68014203-68014225 GAAATAAGGGAGATGTGGACAGG 0: 1
1: 0
2: 3
3: 28
4: 260
1084267859_1084267864 -8 Left 1084267859 11:68014183-68014205 CCTCCCAGTCTAATGAGGGGGAA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1084267864 11:68014198-68014220 AGGGGGAAATAAGGGAGATGTGG 0: 1
1: 0
2: 5
3: 66
4: 707
1084267859_1084267867 2 Left 1084267859 11:68014183-68014205 CCTCCCAGTCTAATGAGGGGGAA 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1084267867 11:68014208-68014230 AAGGGAGATGTGGACAGGGTTGG 0: 1
1: 0
2: 4
3: 60
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084267859 Original CRISPR TTCCCCCTCATTAGACTGGG AGG (reversed) Intronic
902777889 1:18686207-18686229 TTCTCCCCCATGAGATTGGGAGG + Intronic
902956860 1:19931315-19931337 TACCGCCTCAGCAGACTGGGGGG - Intergenic
903459464 1:23510245-23510267 TTCTCTCTCCTTAGCCTGGGTGG + Intronic
904209006 1:28873514-28873536 TTCCCCCTCAAGAGACTTTGAGG - Intergenic
905792593 1:40798137-40798159 TTCCCCCTCAGAAGAATGAGGGG - Intronic
907388899 1:54143849-54143871 CTCTCCCTCACTAGACTGAGAGG + Exonic
909174021 1:72332416-72332438 TTCTCCCTCATTAGAATTGGAGG - Intergenic
909512424 1:76469651-76469673 TTACCTGTCATTAGACTGGTTGG - Intronic
917453524 1:175166729-175166751 CTCCCCCTTGCTAGACTGGGCGG - Exonic
917601527 1:176579011-176579033 TTCCCCCTCATTAGGGTGGTGGG + Intronic
918194852 1:182211708-182211730 TTCCCATGCATTAGACTGGTGGG + Intergenic
920376746 1:205512849-205512871 CTCCCCCTCCTGAGACTGAGAGG + Intronic
922453979 1:225759434-225759456 TTCCACCACATTAGTCAGGGTGG - Intergenic
923972196 1:239217062-239217084 TTCTCCCACATTAGGCGGGGGGG + Intergenic
1063804702 10:9625164-9625186 TTGCCCCTAATCAGAGTGGGTGG + Intergenic
1066073597 10:31848019-31848041 ATCCCCCTCCTGAGACTGGGAGG + Intronic
1068699789 10:60007697-60007719 TTCCCCCTCTTTGGAGTAGGTGG + Intergenic
1075065762 10:119287991-119288013 TTCCCCCTCTCTGGACTGGACGG + Intronic
1075391657 10:122096715-122096737 CTGCCCCTCACCAGACTGGGAGG + Intronic
1076353779 10:129838042-129838064 TTCCCCCCTATTCAACTGGGAGG + Intronic
1082268752 11:50146733-50146755 TTCCCCATCTTTAAAGTGGGGGG - Intergenic
1084267859 11:68014183-68014205 TTCCCCCTCATTAGACTGGGAGG - Intronic
1086386668 11:86316146-86316168 TTCCCTATCATTAGACTAAGTGG + Intronic
1093234801 12:16594643-16594665 TTTCCCTTCATTACACTGTGGGG - Intronic
1102693398 12:114779340-114779362 TTCTCCCTCATTTGACTAGCAGG - Intergenic
1103947546 12:124534992-124535014 TTCTCCATCTGTAGACTGGGCGG - Intronic
1103969458 12:124660938-124660960 TTCCCCCTAATTTGGCGGGGTGG - Intergenic
1106921986 13:34573981-34574003 TTCACCCTCATGAACCTGGGAGG + Intergenic
1108870767 13:54982532-54982554 TTCACCCTCATTAGAGTGTTGGG - Intergenic
1111567490 13:90034686-90034708 TTTCCCCCCATCAGACTGGCTGG + Intergenic
1117220374 14:53598673-53598695 TTCTCCCTCATTAGATTATGGGG + Intergenic
1117602088 14:57386513-57386535 TCCACCCTCTTAAGACTGGGAGG + Intergenic
1120984119 14:90318422-90318444 TTCACACTCATTAGACAGTGTGG - Intronic
1121594825 14:95153861-95153883 TTCCACCTCCTTAGCCTGTGGGG - Intronic
1130075558 15:80686156-80686178 TTCACCCTCATTAATGTGGGAGG - Intronic
1130245880 15:82248265-82248287 TTACCCCTCATTTGACTGAAGGG - Intronic
1130454816 15:84095111-84095133 TTACCCCTCATTTGACTGAAGGG + Intergenic
1131950929 15:97681073-97681095 AGCCCCATCATTAGTCTGGGCGG - Intergenic
1133781572 16:8942885-8942907 TGCACCCTCATTAGGCTGGCTGG + Intronic
1141333808 16:83136581-83136603 ATCCCCCTCATTCCACAGGGAGG + Intronic
1142255894 16:89013803-89013825 GTCCCCCTCCTGAGCCTGGGTGG - Intergenic
1142870253 17:2815117-2815139 TTCTGCCTCATCAGCCTGGGTGG + Intronic
1143048260 17:4100442-4100464 TTTCCCCTCCTTAGATTGAGTGG - Intronic
1143587205 17:7856280-7856302 CTCCCCCTCAATAGAGTGGAGGG + Intergenic
1147048914 17:37776458-37776480 TTCCCCCAAATTACACTGTGAGG - Intergenic
1148439871 17:47706389-47706411 ATCTCCCCCATCAGACTGGGAGG - Intronic
1162235309 19:9304392-9304414 TTCCCCCTCACAAAACTGAGAGG + Intronic
1162519935 19:11173823-11173845 GTCTCACTCATTAGACTAGGAGG + Intronic
1163630369 19:18415299-18415321 CTCCTCCTCATTAAAGTGGGGGG - Intergenic
1164381454 19:27740024-27740046 TTCTCTCTCATTAGACTGCCTGG + Intergenic
1165395679 19:35562453-35562475 GTCCCCCTCACTAGCCTGGATGG + Exonic
1166529228 19:43532798-43532820 TTCCCCCTCGGAAGCCTGGGTGG - Intronic
1166801998 19:45463601-45463623 TGCCCACTCATGAGACTGGTGGG - Intronic
1167036346 19:46997348-46997370 TTCCTCCTCATTAGGCTGCCCGG + Intronic
1167732927 19:51272033-51272055 TTCCTCCTCGGTAGAATGGGAGG - Intergenic
1168340485 19:55620603-55620625 TTCCCCATCATCAGAATGGGGGG - Intergenic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
925925861 2:8669827-8669849 TTCCTCTTCCTTAGTCTGGGTGG + Intergenic
926153853 2:10439734-10439756 GTCCCCCTCATGAGGCTGGTGGG + Intergenic
927936860 2:27080925-27080947 AGCCCCCTCAGTGGACTGGGGGG + Exonic
930887257 2:56340501-56340523 TTGCCCCTAATTCGACTGAGGGG + Intronic
932577916 2:72972898-72972920 TTCCCCCTCCTTCCAGTGGGGGG + Intronic
934881630 2:97986608-97986630 GTCCACCTCATTATTCTGGGTGG - Intronic
935671998 2:105563771-105563793 CACCCGCTCATTAGGCTGGGAGG + Intergenic
937301410 2:120844937-120844959 TGCCCCCTGTGTAGACTGGGTGG + Intronic
938388046 2:130881919-130881941 TACCCCCTCTCTAGTCTGGGTGG + Intronic
940140599 2:150487106-150487128 TTTCCCCTGATTAGACTGCGGGG - Intronic
942526727 2:176861093-176861115 TCCATCCTCATTAGACTGTGGGG - Intergenic
942578083 2:177386728-177386750 TTCCCCCACATTGGTATGGGGGG - Intronic
948597522 2:239089905-239089927 CTCCCTCTCATCAGGCTGGGAGG - Intronic
1169774796 20:9240772-9240794 TTCCCTTTCATTTGATTGGGGGG + Intronic
1174336229 20:49862684-49862706 TTCTCCCTCATTAGCCTGAGGGG + Intronic
1180659680 22:17455341-17455363 TTCCTCCTAATTAGATGGGGAGG + Intronic
1181584874 22:23847631-23847653 TTCACTTTCATGAGACTGGGGGG + Intergenic
1182053048 22:27327871-27327893 TTCCCCCTCATCAGCCTGCTGGG - Intergenic
1182923294 22:34099675-34099697 TTATTCCTAATTAGACTGGGAGG - Intergenic
950016304 3:9757221-9757243 CTCCCCAACATGAGACTGGGTGG - Intronic
950226303 3:11237503-11237525 TTCCACATCATTAAAATGGGAGG + Intronic
951591051 3:24265086-24265108 TTAGCCATCAGTAGACTGGGGGG + Intronic
951908431 3:27725610-27725632 AGCACCCTCCTTAGACTGGGTGG + Intergenic
956162079 3:66365841-66365863 TTGCCCCTGATTAGTCTGGAAGG - Intronic
970290134 4:14562971-14562993 CTCCCACTCCTTAGACTGTGAGG - Intergenic
970528420 4:16956549-16956571 TTCCCCAACATTAGTCAGGGAGG - Intergenic
977334708 4:95682651-95682673 TTCTCCCACTTTAGAGTGGGTGG - Intergenic
980231987 4:130057186-130057208 TTCTCCCTAATAAGCCTGGGAGG - Intergenic
982650509 4:158082575-158082597 CTCCCCCTGATTTGACTGGGGGG + Intergenic
988918795 5:35921879-35921901 TTCCTCCTCTTTTAACTGGGAGG + Intronic
995015224 5:107302183-107302205 TTTCCCATCATTACACTGGAGGG - Intergenic
995491165 5:112692973-112692995 TTCTGCCTCATTAGACAAGGAGG + Intergenic
999196274 5:149783700-149783722 TTCCCCCTCTTTACATTGAGAGG + Intronic
1001661314 5:173395657-173395679 GTCTCCCTCATTAGATTTGGGGG + Intergenic
1002136897 5:177113144-177113166 TTCCTCCTCTGTAGAATGGGAGG - Intergenic
1004075615 6:12341746-12341768 TGGCCCCTCATTTGACTGTGAGG - Intergenic
1004496202 6:16165648-16165670 TTCCCCCTCATTTGGCAGGGGGG - Intergenic
1007512011 6:42381048-42381070 CTCTCCCCCATCAGACTGGGAGG + Intronic
1007692662 6:43712838-43712860 CTCCCCCTCATTATCCTGGCTGG - Intergenic
1008689486 6:53961818-53961840 TTTCCCCTCATTTAACTGGAAGG + Intronic
1012115064 6:95286218-95286240 TTCCCCCTAATTAAATTAGGGGG + Intergenic
1015615205 6:135067329-135067351 TTCCTCCCCATAAAACTGGGCGG + Intronic
1021268497 7:18554782-18554804 TTCTCTCTTCTTAGACTGGGTGG + Intronic
1023061818 7:36334778-36334800 TTCCCCTACATTAAACTGAGGGG - Intronic
1026350888 7:69514169-69514191 TGCCCCCTCACTAGACTGCAGGG + Intergenic
1038351348 8:26779006-26779028 TTACTCTTCTTTAGACTGGGTGG - Intronic
1040105804 8:43541103-43541125 TTCTCCCTTATTAGCCCGGGTGG - Intergenic
1046803135 8:118450734-118450756 TTCCACCTCTTGAGTCTGGGTGG + Intronic
1048821454 8:138384283-138384305 TTCCTCCCCTTTAGTCTGGGAGG + Intronic
1050034519 9:1421435-1421457 TTTCCCCTAATTCCACTGGGTGG + Intergenic
1052538658 9:29778828-29778850 TTCCCCCTCAATCACCTGGGAGG + Intergenic
1053189184 9:36047232-36047254 CCTACCCTCATTAGACTGGGAGG - Intronic
1058045612 9:100353661-100353683 TTGACCCTCATTATATTGGGTGG + Intergenic
1059458205 9:114412938-114412960 CTTCCCCTCATTACAATGGGAGG + Intronic
1059568500 9:115408593-115408615 TCCCCCCCCATTAGAAAGGGTGG - Intergenic
1061275675 9:129568562-129568584 TTCCCCATCTGTAAACTGGGTGG - Intergenic
1062669093 9:137695800-137695822 ATCCCCCTCCTTTGCCTGGGTGG - Intronic
1189213621 X:39304964-39304986 TTCCCCTTTATTAGTCTGGTAGG + Intergenic
1190496798 X:51034172-51034194 CTCCTCCTCAGGAGACTGGGAGG - Intergenic
1190509171 X:51159765-51159787 CTCCTCCTCAGGAGACTGGGAGG + Intergenic
1192503360 X:71667044-71667066 CTGCCCGTCATTTGACTGGGTGG + Intergenic
1192510579 X:71718457-71718479 ATGCCCGTCATTTGACTGGGTGG + Intergenic
1192516118 X:71763096-71763118 ATGCCCGTCATTTGACTGGGTGG - Intergenic
1194655001 X:96561974-96561996 TTCCCCTTCATTTAACTGTGTGG + Intergenic
1196023033 X:111010277-111010299 TTCCCCAGCATGAAACTGGGTGG - Intronic
1196490778 X:116263227-116263249 ATCCCCTTGATTAGACTGGGTGG + Intergenic