ID: 1084270574

View in Genome Browser
Species Human (GRCh38)
Location 11:68027149-68027171
Sequence CCTCTAAGGCTCCCCAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 188}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084270563_1084270574 19 Left 1084270563 11:68027107-68027129 CCTGAGCTCTGCCCAGGTCCCTA 0: 1
1: 0
2: 6
3: 30
4: 314
Right 1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188
1084270561_1084270574 25 Left 1084270561 11:68027101-68027123 CCACAGCCTGAGCTCTGCCCAGG 0: 1
1: 0
2: 10
3: 94
4: 714
Right 1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188
1084270567_1084270574 1 Left 1084270567 11:68027125-68027147 CCCTAACACACCGCATGGCACCC 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188
1084270568_1084270574 0 Left 1084270568 11:68027126-68027148 CCTAACACACCGCATGGCACCCA 0: 1
1: 0
2: 2
3: 14
4: 214
Right 1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188
1084270560_1084270574 26 Left 1084270560 11:68027100-68027122 CCCACAGCCTGAGCTCTGCCCAG 0: 1
1: 1
2: 4
3: 38
4: 477
Right 1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188
1084270564_1084270574 8 Left 1084270564 11:68027118-68027140 CCCAGGTCCCTAACACACCGCAT 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188
1084270569_1084270574 -9 Left 1084270569 11:68027135-68027157 CCGCATGGCACCCACCTCTAAGG 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188
1084270565_1084270574 7 Left 1084270565 11:68027119-68027141 CCAGGTCCCTAACACACCGCATG 0: 1
1: 0
2: 0
3: 29
4: 913
Right 1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084270574 Original CRISPR CCTCTAAGGCTCCCCAAGCC TGG Intronic
900519783 1:3100005-3100027 CCTCTACGGCTCCCTCACCCAGG - Intronic
900673337 1:3869369-3869391 CATCTAAGTCTCACCCAGCCTGG + Intronic
901007904 1:6180478-6180500 CCTCGACGGCTCCCCCTGCCGGG - Intergenic
902768819 1:18633925-18633947 TCTCTAAGGCTCTACCAGCCTGG + Intronic
904291412 1:29488425-29488447 TCTCTCGGGCTCCCCAAGCTGGG - Intergenic
904481714 1:30798003-30798025 CCTCCAGGGCTCCCCAGTCCTGG - Intergenic
904529461 1:31158739-31158761 CCTGTAGGCCTCCCAAAGCCTGG - Intergenic
904973395 1:34436513-34436535 CCTCTAAGGCTCACCTGCCCAGG - Intergenic
907461499 1:54608191-54608213 ACTCTCAGGCTCCCCCAGGCTGG - Intronic
910825709 1:91404845-91404867 CCTCTGAGGACCGCCAAGCCTGG + Exonic
911055830 1:93707732-93707754 GCTCTGACGGTCCCCAAGCCTGG + Intronic
915543144 1:156581561-156581583 CCTCCAAGGCCCCACAAACCAGG + Exonic
917312411 1:173691054-173691076 CCTCTAAGCCACCCCAACCAAGG + Intergenic
917453376 1:175165718-175165740 CTTCCAAGGGTCCCAAAGCCTGG - Intronic
919746407 1:201011719-201011741 CCTCAGAGGCTGCCCAGGCCAGG - Intronic
920682598 1:208084280-208084302 CCTGGAAGGCTCCGGAAGCCAGG + Intronic
920926303 1:210344665-210344687 CCCCAAAGGCTCCCCAAAACGGG - Intronic
922472817 1:225887431-225887453 CAGCTGGGGCTCCCCAAGCCCGG + Exonic
922480829 1:225939393-225939415 CAGCTGGGGCTCCCCAAGCCCGG + Exonic
923279149 1:232425588-232425610 CTTCTCAGGCTCCCCATGCTGGG + Exonic
923545263 1:234918995-234919017 CCACTAAGGCCCCCCACGCCTGG + Intergenic
924567191 1:245208706-245208728 CCTCTACTGCCCCCAAAGCCTGG - Intronic
1063451355 10:6152401-6152423 CCATGGAGGCTCCCCAAGCCAGG + Intronic
1064077375 10:12279962-12279984 CCTATAAATCTCCCCAAGACAGG + Intergenic
1065918086 10:30368743-30368765 CCTCTCAGGCTCCCCAAACTTGG + Intronic
1066007337 10:31157774-31157796 TCTCTAAGTCTGGCCAAGCCTGG - Intergenic
1067205150 10:44206665-44206687 CCGGCAAGGCTCCCCAAGCCCGG + Intergenic
1067848865 10:49742752-49742774 CCCCTCGGGATCCCCAAGCCAGG + Intronic
1068009091 10:51425592-51425614 ACTCTAATGAACCCCAAGCCAGG - Intronic
1069867777 10:71514337-71514359 CCTCCAAGGCTCCCCAGACCTGG - Intronic
1071546610 10:86534741-86534763 CCTCTGATGCGCCCCTAGCCTGG + Intergenic
1073253037 10:102133523-102133545 CCAGTGAGGCTCCCCGAGCCCGG + Intronic
1073255408 10:102147628-102147650 CCTAAAAGTCTCCCCAAGGCAGG - Intronic
1073562167 10:104506351-104506373 CCTCTTCTACTCCCCAAGCCAGG - Intergenic
1075198732 10:120383438-120383460 CACCAAAGGCTCCCCAGGCCTGG - Intergenic
1079163513 11:18015046-18015068 CCTCTACATCTCCCCAACCCTGG + Intergenic
1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG + Intronic
1084428913 11:69100757-69100779 CCTCGAATGCTGCCCGAGCCTGG + Intergenic
1088736591 11:112732690-112732712 GCTCTCAGCCTCCCCAATCCTGG - Intergenic
1089556288 11:119317330-119317352 CCCCTCAGCCTTCCCAAGCCAGG - Intronic
1091689269 12:2584623-2584645 CCTCTAAGCTTGCCCAGGCCTGG + Intronic
1091792830 12:3281379-3281401 CCTATAGGGCTCCCCGTGCCGGG - Intronic
1096571026 12:52523288-52523310 CCTCTAAGTCCCCCCCAGCAGGG + Intergenic
1100981608 12:100166731-100166753 CCTCTCAGGCTCCCCAAACTTGG + Intergenic
1102605624 12:114065266-114065288 CCTCTAAGCCACCCCAACCAGGG - Intergenic
1108151994 13:47545870-47545892 GCTCCAAGGCTCCTCTAGCCTGG - Intergenic
1110580412 13:77116379-77116401 CATTTAAGACTCCCCAAGCAAGG - Intronic
1117052721 14:51877889-51877911 CCTCAAAGGCTCTCCAACTCAGG - Intronic
1118862412 14:69674731-69674753 ACTCTAATTCTCTCCAAGCCAGG - Intronic
1121294368 14:92806226-92806248 CCTCTAAGGATACTCAAGTCTGG - Intronic
1121408218 14:93732326-93732348 CCTGTGGGGCTCCCCAAGCTGGG + Intronic
1121585246 14:95058797-95058819 CCTCTAATTCTCACCAAACCGGG - Intergenic
1123473007 15:20568723-20568745 CCTCTCAGGCTCCTCAAACTTGG - Intergenic
1123644999 15:22431630-22431652 CCTCTCAGGCTCCTCAAACTTGG + Intergenic
1123666291 15:22611406-22611428 CCTCTCAGGCTCCTCAAACTTGG + Intergenic
1124320112 15:28705812-28705834 CCTCTCAGGCTCCTCAAACTTGG + Intronic
1124482400 15:30089605-30089627 CCTCTCAGGCTCCTCAAACTTGG - Intronic
1124488859 15:30141707-30141729 CCTCTCAGGCTCCTCAAACTTGG - Intronic
1124521177 15:30407604-30407626 CCTCTCAGGCTCCTCAAACTTGG + Intronic
1124537485 15:30558616-30558638 CCTCTCAGGCTCCTCAAACTTGG - Intronic
1124543943 15:30610671-30610693 CCTCTCAGGCTCCTCAAACTTGG - Intronic
1124563910 15:30798097-30798119 CCTCTCAGGCTCCCCAAACTTGG - Intergenic
1124754671 15:32396616-32396638 CCTCTCAGGCTCCTCAAACTTGG + Intronic
1124761171 15:32448971-32448993 CCTCTCAGGCTCCTCAAACTTGG + Intronic
1124777463 15:32600092-32600114 CCTCTCAGGCTCCTCAAACTTGG - Intronic
1127774527 15:62254736-62254758 CCCCTCAGGCTCCCCAAACTTGG + Intergenic
1128053419 15:64682647-64682669 ACTCCAAGGTTCCCCAAGCTGGG - Exonic
1128082027 15:64862416-64862438 TGTCTGAGGTTCCCCAAGCCTGG + Intronic
1129037914 15:72662125-72662147 CCTCTCAGGCTTCCCAAACTTGG - Intronic
1129211975 15:74075102-74075124 CCTCTCAGGCTTCCCAAACTTGG + Intronic
1129398428 15:75265983-75266005 CCTCTCAGGCTTCCCAAACTTGG - Intronic
1129402036 15:75290258-75290280 CCTCTCAGGCTTCCCAAACTTGG - Intronic
1129475572 15:75782717-75782739 CCTCTCAGGCTTCCCAAACTTGG - Intergenic
1129729101 15:77919423-77919445 CCTCTCAGGCTTCCCAAACTTGG + Intergenic
1130259696 15:82345506-82345528 CCTCTCAGGCTTCCCAAACTTGG + Intronic
1130269023 15:82433930-82433952 CCTCTCAGGCTTCCCAAACTTGG - Intronic
1130281538 15:82523503-82523525 CCTCTCAGGCTTCCCAAACTTGG - Intergenic
1130472911 15:84239686-84239708 CCTCTCAGGCTTCCCAAACTTGG - Intronic
1130480402 15:84354257-84354279 CCTCTCAGGCTTCCCAAACTTGG - Intergenic
1130484617 15:84391811-84391833 CCTCTCAGGCTTCCCAAACTTGG - Intergenic
1130491367 15:84433872-84433894 CCTCTCAGGCTTCCCAAACTTGG + Intergenic
1130502983 15:84512912-84512934 CCTCTCAGGCTTCCCAAACTTGG + Intergenic
1130595203 15:85244320-85244342 CCTCTCAGGCTTCCCAAACTTGG - Intergenic
1131259372 15:90880638-90880660 CCTCTGCGGGACCCCAAGCCAGG - Intronic
1131282783 15:91034387-91034409 CCTCTCAGGCTCCCCAAACTTGG + Intergenic
1132071130 15:98777393-98777415 CCTCTCAGACTCCCAAACCCTGG - Intronic
1132348269 15:101121536-101121558 CCTGTAAGGCGCGCCCAGCCTGG - Intergenic
1132432994 15:101775599-101775621 CCTCTCAGGCTCCCCGAACTTGG + Intergenic
1138100230 16:54246454-54246476 CCTCTACAGCCCCACAAGCCAGG + Intronic
1138492564 16:57384795-57384817 CCTGGAAGGCTCTCCCAGCCTGG - Exonic
1141388465 16:83644852-83644874 CCTCTAAGGCACAGCAAGGCAGG + Intronic
1141749241 16:85947113-85947135 CCTGCCAGGTTCCCCAAGCCTGG - Intergenic
1143102486 17:4512160-4512182 CCTGTAAGGCCCCCAAAGGCAGG + Intronic
1143444991 17:7002958-7002980 CCACCAAGACCCCCCAAGCCTGG + Intronic
1143752328 17:9037595-9037617 CCTCTAAACCTTCCCAGGCCTGG + Intronic
1146591773 17:34133587-34133609 CTACGAAGGCTCCTCAAGCCAGG - Intronic
1146909810 17:36641481-36641503 CGCCTAAGGCGCCCCAGGCCCGG - Intergenic
1147411656 17:40257270-40257292 CCACTAAGAATCCTCAAGCCGGG - Intronic
1148071517 17:44911494-44911516 CCTCGAAACCTCCCCAAGTCGGG - Intronic
1152239058 17:79152170-79152192 CCTCTGGGGCTCCCCAACCCTGG - Intronic
1153596491 18:6730123-6730145 GCTCGAAGGCTCCACCAGCCTGG + Intronic
1156074111 18:33251774-33251796 CCTCTAGGGCCCACCAAACCAGG + Intronic
1156948500 18:42864788-42864810 CCACTAAGCCTCGCCAAGGCAGG + Intronic
1159857873 18:73611013-73611035 CTTCTAATTCTCCCAAAGCCAGG - Intergenic
1160789819 19:918253-918275 CTGCTTAGGCTCCCCCAGCCCGG + Intronic
1160831543 19:1106862-1106884 CCTCCATGGCACCCCCAGCCTGG - Intergenic
1161059885 19:2209609-2209631 CCACTGTGGCTCCCCAAGCCAGG - Intronic
1161319656 19:3635017-3635039 CCACATAGGCTCCCCATGCCGGG - Intronic
1161574842 19:5049507-5049529 CCTCTCAGGCCCCTCATGCCAGG - Intronic
1162154084 19:8664796-8664818 CATCTCAGGCCCCCCAAGTCTGG + Intergenic
1164156389 19:22600075-22600097 CCTCTCAGGCTCCACAAACTTGG - Intergenic
1164533836 19:29069387-29069409 CCTCTGAGGGACCCCAAGCCAGG + Intergenic
1164642658 19:29837871-29837893 CCTCTAAGGCACATCAAGGCCGG + Intergenic
1165064949 19:33223641-33223663 CCTCAAAGGCTCCCCGGGCCAGG + Intronic
1165124096 19:33581757-33581779 CCTTTAATGCTCCCCTTGCCAGG + Intergenic
1165431666 19:35776442-35776464 CCCATAAGGTTCCCCAAGGCAGG - Intronic
1167171975 19:47839511-47839533 CCCCTCAGGCTCCCCAACCACGG + Exonic
925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG + Intronic
926791652 2:16577923-16577945 CCTCTAGGGCCCACCATGCCAGG + Intronic
927502771 2:23593426-23593448 CCTTTTACTCTCCCCAAGCCCGG + Intronic
928184370 2:29096339-29096361 GCTCCAAGGCTCCCCTCGCCTGG + Intergenic
932493993 2:72137677-72137699 CCTCTAGGGCCCCCAAGGCCTGG - Intronic
938082559 2:128377955-128377977 CCTCTAAGTCTCCACATCCCTGG + Intergenic
938112568 2:128578735-128578757 CCTCTGAGGCTCCCCACCCACGG + Intergenic
939852837 2:147320767-147320789 CATCTGAGGCTCCCTCAGCCTGG - Intergenic
940376592 2:152965221-152965243 ACTCTAAGGCTCCCCATACTGGG - Intergenic
940506837 2:154566375-154566397 CCACTAAGTCTTCCCAAGACTGG - Intergenic
941018050 2:160379186-160379208 CCTCTATTGCCCCCCAAGCTGGG - Intronic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
946850715 2:223903971-223903993 CATTTAAGGGTCTCCAAGCCTGG + Intronic
947593609 2:231397943-231397965 CCTCTCAGGGGCCCCAGGCCTGG + Exonic
947634551 2:231673428-231673450 CTTCCAAGGCCCCCCAACCCTGG + Intergenic
948072333 2:235138010-235138032 CCTCTCTGTCTCCCCAGGCCAGG + Intergenic
948424091 2:237876924-237876946 CCTCTCATGCTGCCCATGCCTGG + Intronic
948623799 2:239253990-239254012 CCTCTATTGCTTCCCAGGCCTGG - Intronic
949044877 2:241867847-241867869 CCTCTCAGGCTCCTCAGCCCTGG - Intergenic
1171880031 20:30611646-30611668 TCTCTATGGCTCCACAAGACTGG + Intergenic
1172057737 20:32166027-32166049 CCTCCAGGGCTGCCCAAGGCAGG + Exonic
1172323566 20:34016915-34016937 CCTCCCAGGCTCCCCAGGCCTGG - Intronic
1173160294 20:40647356-40647378 CCTCTAGGGCTCCAGAGGCCAGG + Intergenic
1174719714 20:52798905-52798927 CCCCTAAGGCTCAACAAGGCTGG - Intergenic
1181041678 22:20195334-20195356 CCTAAAAGCCTCCCCAACCCAGG - Intergenic
1181756415 22:25028115-25028137 CCTCTGGGGCTCCCCCAGCCCGG + Exonic
1182472568 22:30557454-30557476 CCCCCAAGGCTGCCCAGGCCTGG + Intronic
1182578844 22:31291657-31291679 CCTCAAAGGGACCCTAAGCCAGG - Intronic
949946020 3:9190844-9190866 CCCCTAAGGGTCCCCAGCCCTGG - Intronic
950102421 3:10366146-10366168 CCTCAAAGTCCCCCTAAGCCAGG - Intronic
950131339 3:10548876-10548898 CCTCTGAGGCTAAACAAGCCTGG - Intronic
950523983 3:13513043-13513065 CCCCCAAGGCTCTCCCAGCCAGG + Intergenic
952735133 3:36681639-36681661 CATCTGAGGCTCCATAAGCCTGG + Intergenic
953022152 3:39121486-39121508 CTTCTCAGGCTGCCCAGGCCGGG + Intronic
954314951 3:49795923-49795945 CCTGTAAGGCTCCCCTACCCTGG - Exonic
954766898 3:52926099-52926121 CCACCTAGGCTACCCAAGCCAGG - Exonic
961187380 3:124927496-124927518 CCTCAAAGACTCCCCAAGGATGG - Intronic
961995542 3:131238080-131238102 CATTCAAGGCTCCCAAAGCCAGG - Intronic
962414246 3:135168016-135168038 TCTCTAAGGTTACCCAAGGCGGG + Intronic
962918857 3:139933990-139934012 CCTCTCTGGCTCCCCAAGCAGGG + Intergenic
968503680 4:962401-962423 CCTGGAAGGCACCCCACGCCGGG + Intronic
968621095 4:1603813-1603835 CCTCTGAGGCTCCACACCCCAGG - Intergenic
975473307 4:74794388-74794410 CCTCTCAGGCGCCCGAGGCCCGG - Exonic
985323729 4:188743573-188743595 CCTCTAAGCTTCCCCAAGAGGGG - Intergenic
985629709 5:1008296-1008318 CCTCCCAGGAGCCCCAAGCCTGG - Intergenic
985802099 5:2011253-2011275 TGTCCAAGGCTCCCCAAGGCTGG + Intergenic
986032316 5:3905795-3905817 CCTCCAAGACTCTCCAAGCTAGG + Intergenic
986349750 5:6866578-6866600 CCTCTATGGCTACCCACTCCTGG - Intergenic
992406201 5:76460097-76460119 CCTCTAAGGATCCCCTAGTTTGG + Intronic
996928276 5:128855357-128855379 CCACTCAGGCTCCCTAAGCTTGG + Intronic
997208804 5:132065980-132066002 CCTCCACGGCTCCCCCAGGCTGG + Intergenic
997368358 5:133340073-133340095 GCTCTGAGACTCCCCATGCCTGG - Intronic
997613681 5:135232028-135232050 CCCCTCTGTCTCCCCAAGCCAGG - Intronic
997980204 5:138464154-138464176 CGTCGAAGGCTCCCCCGGCCTGG + Intergenic
999390240 5:151184268-151184290 CCTCTAAGACTCTCCCAGCTGGG + Intronic
999905530 5:156137212-156137234 CCTTTGAGGCATCCCAAGCCTGG + Intronic
1001031213 5:168264713-168264735 CCTCAGAGCCTCCCCAAGCATGG + Intergenic
1001109670 5:168885333-168885355 TGTCTCAGGCTCCCCCAGCCAGG + Intronic
1002721061 5:181261643-181261665 CCACAAAGGCACCCCAAGCGCGG - Intergenic
1004280558 6:14276231-14276253 CCTAGAAGGTTCCCCAAACCAGG + Intergenic
1004506838 6:16253752-16253774 CCTCTCTTGCTCCCCAAGCAAGG + Intronic
1007728038 6:43928632-43928654 CTCCACAGGCTCCCCAAGCCTGG + Intergenic
1018891727 6:167987681-167987703 CCTCGAAGGCCCCACAAGCCAGG + Intergenic
1019001975 6:168761514-168761536 CCTCAAAGGCTGCCCATTCCTGG - Intergenic
1019119966 6:169794567-169794589 CCAGGCAGGCTCCCCAAGCCAGG + Intergenic
1019655202 7:2189920-2189942 CCTCTAAGGCTGACAAGGCCAGG + Intronic
1022258988 7:28685835-28685857 CCACGAAGGCTCTCCGAGCCTGG + Intronic
1025715771 7:63953814-63953836 CCTCTAAGGCCCCCGTAGGCAGG + Intergenic
1026177665 7:68012281-68012303 TTTCTATGGCTCCCCAAGCATGG + Intergenic
1028333532 7:89624945-89624967 CCTCTAAGCCACCCCAACCAAGG - Intergenic
1030804275 7:113895089-113895111 CCTCTAATGTTCCCCAAGATGGG + Intronic
1031989692 7:128189543-128189565 CCTCTAAGGAGCCCCAGACCTGG - Intergenic
1034405792 7:150901667-150901689 CCTCCACAGTTCCCCAAGCCTGG - Intergenic
1034506728 7:151498166-151498188 CCTTGAAGGTTCCTCAAGCCAGG - Intronic
1037472027 8:19220012-19220034 CCTCTTACCGTCCCCAAGCCTGG - Intergenic
1037750356 8:21678043-21678065 CTTCTCTGGCTCCCCAAGGCTGG - Intergenic
1039547723 8:38421708-38421730 CCTCTGTGTCTCCCCAAGCCTGG + Intronic
1043327026 8:79064964-79064986 CCTCTGAGTCTCCCAAAGGCAGG - Intergenic
1046382813 8:113473039-113473061 GCTCAAAGGCTCCCCATACCAGG - Intergenic
1049535228 8:143177141-143177163 ATTCAAAGGCTCCCCATGCCAGG - Intergenic
1049581220 8:143411944-143411966 CCTCTTGGGGTCCCCCAGCCTGG + Intergenic
1061063154 9:128260870-128260892 CCTCTCAAGCTCCCCAAACTTGG + Intronic
1062125067 9:134855773-134855795 CGTCTCATGCTCCCCAAGGCAGG + Intergenic
1187902121 X:24035025-24035047 GCTCTGAGGCTGCCCAGGCCGGG - Intergenic
1188195008 X:27222629-27222651 CCCCAGGGGCTCCCCAAGCCAGG + Intergenic
1192432144 X:71119538-71119560 CCTATAAGTCTTCCCAACCCAGG - Intronic
1193848997 X:86512354-86512376 CCTCTAATGCTTCCCAAGCCTGG + Intronic
1202366927 Y:24171993-24172015 CCTCTCAGGCTTCCCAAACTTGG - Intergenic
1202373479 Y:24213489-24213511 CCTCTCAGGCTTCCCAAACTTGG + Intergenic
1202497302 Y:25456631-25456653 CCTCTCAGGCTTCCCAAACTTGG - Intergenic
1202503855 Y:25498130-25498152 CCTCTCAGGCTTCCCAAACTTGG + Intergenic