ID: 1084270574

View in Genome Browser
Species Human (GRCh38)
Location 11:68027149-68027171
Sequence CCTCTAAGGCTCCCCAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 188}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084270568_1084270574 0 Left 1084270568 11:68027126-68027148 CCTAACACACCGCATGGCACCCA 0: 1
1: 0
2: 2
3: 14
4: 214
Right 1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188
1084270569_1084270574 -9 Left 1084270569 11:68027135-68027157 CCGCATGGCACCCACCTCTAAGG 0: 1
1: 0
2: 0
3: 13
4: 159
Right 1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188
1084270564_1084270574 8 Left 1084270564 11:68027118-68027140 CCCAGGTCCCTAACACACCGCAT 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188
1084270567_1084270574 1 Left 1084270567 11:68027125-68027147 CCCTAACACACCGCATGGCACCC 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188
1084270561_1084270574 25 Left 1084270561 11:68027101-68027123 CCACAGCCTGAGCTCTGCCCAGG 0: 1
1: 0
2: 10
3: 94
4: 714
Right 1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188
1084270565_1084270574 7 Left 1084270565 11:68027119-68027141 CCAGGTCCCTAACACACCGCATG 0: 1
1: 0
2: 0
3: 29
4: 913
Right 1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188
1084270560_1084270574 26 Left 1084270560 11:68027100-68027122 CCCACAGCCTGAGCTCTGCCCAG 0: 1
1: 1
2: 4
3: 38
4: 477
Right 1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188
1084270563_1084270574 19 Left 1084270563 11:68027107-68027129 CCTGAGCTCTGCCCAGGTCCCTA 0: 1
1: 0
2: 6
3: 30
4: 314
Right 1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084270574 Original CRISPR CCTCTAAGGCTCCCCAAGCC TGG Intronic