ID: 1084273031

View in Genome Browser
Species Human (GRCh38)
Location 11:68039085-68039107
Sequence GCGCGCCGCGCCTCCGCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084273031_1084273034 -10 Left 1084273031 11:68039085-68039107 CCAGCAGCGGAGGCGCGGCGCGC 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1084273034 11:68039098-68039120 CGCGGCGCGCAGCACACCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 192
1084273031_1084273036 6 Left 1084273031 11:68039085-68039107 CCAGCAGCGGAGGCGCGGCGCGC 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1084273036 11:68039114-68039136 CCCGGGGTGAGTGCCCCTGCCGG 0: 1
1: 0
2: 0
3: 11
4: 200
1084273031_1084273038 7 Left 1084273031 11:68039085-68039107 CCAGCAGCGGAGGCGCGGCGCGC 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1084273038 11:68039115-68039137 CCGGGGTGAGTGCCCCTGCCGGG 0: 1
1: 0
2: 0
3: 24
4: 307
1084273031_1084273039 8 Left 1084273031 11:68039085-68039107 CCAGCAGCGGAGGCGCGGCGCGC 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1084273039 11:68039116-68039138 CGGGGTGAGTGCCCCTGCCGGGG 0: 1
1: 0
2: 2
3: 13
4: 120
1084273031_1084273040 15 Left 1084273031 11:68039085-68039107 CCAGCAGCGGAGGCGCGGCGCGC 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1084273040 11:68039123-68039145 AGTGCCCCTGCCGGGGTCTGCGG 0: 1
1: 0
2: 1
3: 19
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084273031 Original CRISPR GCGCGCCGCGCCTCCGCTGC TGG (reversed) Exonic
900172127 1:1274198-1274220 CCGCGCCGCGCCTCCCCTAAGGG - Intergenic
900676073 1:3887156-3887178 GCGTGCTGCGTCTCCTCTGCAGG + Intergenic
901859132 1:12063187-12063209 GCCCGCCGCACCTGGGCTGCGGG - Intergenic
902286123 1:15409814-15409836 GCGCGCCCCGCCCCCGCCCCCGG - Intergenic
904256877 1:29259863-29259885 GCGCCCCGCTCTGCCGCTGCAGG - Exonic
904769085 1:32870961-32870983 GGGCGGGGCGCCCCCGCTGCGGG + Intronic
905390812 1:37634495-37634517 GCCCGCCGCGCCCCAGCTCCCGG + Intronic
905569332 1:38991446-38991468 GGGCGCAGCGCCGCCGCTTCGGG - Exonic
905580895 1:39082023-39082045 GCGCGCCCCTCCTCCGCCGTGGG + Intronic
906640342 1:47437677-47437699 GGGCGTAGCGCCTCCGCTGAGGG - Exonic
907285447 1:53376807-53376829 GCACCCCACCCCTCCGCTGCTGG + Intergenic
911219718 1:95234114-95234136 GCGCCCCGCGCCTCCGCAACCGG - Intronic
914197395 1:145454552-145454574 GCGCCCCGCGCCCTCCCTGCCGG - Intergenic
914433600 1:147641108-147641130 GCCCGCCCAGCCTCCTCTGCAGG + Intronic
914758377 1:150579441-150579463 GCGGGTGGCGCCGCCGCTGCCGG + Exonic
915238455 1:154502447-154502469 GCGCCCCTCCCCTCCGCGGCTGG + Intronic
922586410 1:226737555-226737577 GCGCGCGGAGCCGCGGCTGCCGG - Exonic
922757300 1:228103450-228103472 GCGCACTGCGCCTACCCTGCCGG + Exonic
1063664713 10:8054455-8054477 GCCCGCCGCCCCTCCGCCGGCGG + Intronic
1072141627 10:92593478-92593500 GAGCGCTGCGGCTTCGCTGCTGG + Intronic
1072757389 10:98030249-98030271 GCGCGCGGAGCCTCCCCCGCGGG - Intronic
1074843075 10:117374677-117374699 GCGGGCAGCGCCTCCCCTTCAGG + Exonic
1075031949 10:119029763-119029785 GCGCGCCGCCTCCCCGCCGCCGG - Exonic
1075106274 10:119542210-119542232 ACGCTCTCCGCCTCCGCTGCGGG - Intronic
1075393746 10:122112616-122112638 GCGGCCCGCGCTTCCTCTGCGGG - Intronic
1076878800 10:133230266-133230288 GCGCGCCGCGCCCCAGCCCCGGG + Exonic
1080515463 11:33015838-33015860 GCAGGCCCCGCCCCCGCTGCCGG - Intergenic
1084273031 11:68039085-68039107 GCGCGCCGCGCCTCCGCTGCTGG - Exonic
1089078855 11:115760098-115760120 GCGCCCAGCGCCCCCGCCGCGGG + Intergenic
1090736933 11:129618335-129618357 CCGCGCTGCGCCTCTGCTTCAGG + Intergenic
1091243264 11:134069284-134069306 GCGCGCCGCCCCTCCGGCCCGGG - Intronic
1092002576 12:5044339-5044361 GCGGCCCTTGCCTCCGCTGCCGG + Exonic
1092181835 12:6451601-6451623 GCCAGCTGCGCCTGCGCTGCAGG + Exonic
1092385374 12:8032713-8032735 GCTCGGCTCGGCTCCGCTGCAGG - Exonic
1092572503 12:9740078-9740100 GCTCTCGGCGCCTCCTCTGCCGG - Intergenic
1095271458 12:40224610-40224632 GCACTGCGCGCCTCCGCTGCGGG + Intronic
1095440829 12:42237854-42237876 GCGCGCCGCGCTCCGGCTGAGGG + Intronic
1101466797 12:104957967-104957989 GCTCCCCGCGCCCCCGCCGCCGG + Intronic
1102853909 12:116277343-116277365 GCGCCCCGGGCCGGCGCTGCGGG + Intergenic
1103479242 12:121240651-121240673 GCGCGCCGCGTCGCCTCTGGGGG - Exonic
1104929195 12:132329355-132329377 GCGCGCCGGGCCACGGCCGCCGG + Intergenic
1105407110 13:20142163-20142185 GGGCGCGGCGCCCCTGCTGCTGG - Exonic
1106665387 13:31846497-31846519 GCGCGCTCGGCCTCCGCTCCTGG - Intergenic
1113378210 13:109783236-109783258 GCCGCCCGCGCCTCCCCTGCTGG - Exonic
1113942610 13:114026256-114026278 GCTCCCCCCGCCTCGGCTGCTGG - Intronic
1114122742 14:19688094-19688116 GCGCGCCGCGCCGCCTGAGCCGG - Intergenic
1114485117 14:23057495-23057517 GGGCGCCGCGGCTCCGCTGCAGG + Exonic
1114659262 14:24334471-24334493 GTGAGCCGAGCCTCTGCTGCGGG - Intronic
1116886995 14:50231497-50231519 GGTCGCCGCGCTTCCTCTGCGGG - Exonic
1116887104 14:50231912-50231934 GCGGGCCGAGCCTCGGCTGCTGG - Intergenic
1118809033 14:69260494-69260516 GCGCGCCGCGGCTCCCTAGCCGG - Intronic
1122540213 14:102493773-102493795 GGGAGCCGCGCCTGTGCTGCAGG - Intronic
1123474997 15:20582915-20582937 CCGCCCCGCTCCTCCTCTGCCGG + Intergenic
1123643014 15:22417442-22417464 CCGCCCCGCTCCTCCTCTGCAGG - Intergenic
1130224554 15:82046979-82047001 GAGCGCCGCGCCGCCACCGCGGG + Intergenic
1131049065 15:89334541-89334563 GCGCACCGCGGCGCCTCTGCCGG - Intronic
1131290146 15:91100179-91100201 GCGCGCTGCGCCTGGGCGGCTGG + Intronic
1132055954 15:98650111-98650133 CCGCACCGCGTCTCCGCTGCTGG + Intronic
1132365092 15:101251471-101251493 GCCCGCCGGGCCGCCGCCGCAGG + Exonic
1132864221 16:2085672-2085694 GTGCGCCCGGCCCCCGCTGCTGG - Intronic
1135007174 16:18836090-18836112 GCACGGAGCGCCTCTGCTGCAGG + Exonic
1135382731 16:22008123-22008145 GCGGGCCGCGCCGCGGCTGCTGG + Intronic
1136993304 16:35170297-35170319 GCCCGCGTCGCCTCCGCTCCTGG + Intergenic
1137602821 16:49768233-49768255 CCGCGCCGCGCCCCCGTTCCCGG - Intronic
1138514565 16:57528985-57529007 GCCCCCCGCGCCCGCGCTGCTGG - Exonic
1138591154 16:58000414-58000436 TCGCCCCGCGCCTGCCCTGCAGG - Intronic
1141788948 16:86219945-86219967 GCGGGCCAGGCCTCCTCTGCTGG + Intergenic
1142306186 16:89287208-89287230 GAGGGCCGCACCTGCGCTGCTGG - Intronic
1143150728 17:4806757-4806779 GGGGGACGCGCCTCCGCTGCGGG - Intergenic
1143697592 17:8631341-8631363 GCGCTCCGCCCCGCCCCTGCAGG - Intergenic
1145058424 17:19717614-19717636 GCCGGCCACTCCTCCGCTGCAGG - Intronic
1146720439 17:35119840-35119862 TCGCGCCGCGCTGCCGCTTCCGG + Intronic
1148262237 17:46193548-46193570 GCCCGCCGCGCCGCCCCCGCGGG + Intronic
1150423286 17:65056950-65056972 GCGCGCCCGGCCGCGGCTGCGGG - Intergenic
1150768283 17:68020077-68020099 GCGCGCGCCGCCGCCGCTGGGGG - Intergenic
1152718543 17:81911359-81911381 GCTGTCCGCGCCGCCGCTGCGGG - Exonic
1153805717 18:8706714-8706736 GTGAGCCGCGCCTCGGCCGCAGG + Intronic
1156350369 18:36297485-36297507 CCCCGCCCCGCCTCCGCCGCCGG + Intergenic
1157529531 18:48409493-48409515 GCGCCCCGCGCCCGCGCCGCCGG + Intronic
1160453305 18:78979651-78979673 GGGCGCCGCGCCTCCTGTTCCGG - Intergenic
1160623113 18:80184577-80184599 CCGCGCCTCGCTCCCGCTGCGGG - Intronic
1160739655 19:680045-680067 CCGCGCTGCGCCTGCGCTGGGGG - Intronic
1160767026 19:813247-813269 GCGCGCGGGGCCGCCGCCGCTGG - Exonic
1161956919 19:7501245-7501267 GCGCGCCGCGGATCCGCTCTCGG - Exonic
1162021503 19:7870369-7870391 TCTCGCTGCGCCTCCTCTGCAGG - Exonic
1162176217 19:8832303-8832325 CCGCCCCGCGCTTCCGCTTCCGG + Exonic
1163866346 19:19776518-19776540 GCGCGCCGCGCCTGGTATGCTGG - Intergenic
1163895182 19:20052289-20052311 GCGCGCCGCGCCTGATATGCTGG + Intergenic
1164834755 19:31349894-31349916 GGGCGCCGCGCCCCCGCCCCCGG + Intergenic
1165956962 19:39507131-39507153 GCGGGCCGCGCCTGCGCTAACGG + Exonic
1167040283 19:47019753-47019775 GCCCGCCGCGTCTCCGCCCCCGG - Intergenic
1167286965 19:48603736-48603758 GCGGGCTGCGGCCCCGCTGCAGG + Exonic
1168689386 19:58367730-58367752 CCGCGCCGCGCCTTGACTGCAGG - Exonic
927606465 2:24491151-24491173 GCCCGCCGCACTTCCCCTGCCGG - Intergenic
929604974 2:43227606-43227628 GGGCGCGGCGCCCCCACTGCCGG - Intergenic
930872818 2:56184912-56184934 CCGCGCCGCGCCTCCCCACCTGG - Intronic
932699928 2:73985262-73985284 GGGGGCCGCTCCTCCGGTGCGGG + Intergenic
935250075 2:101253110-101253132 GCCCCCCGGGCCTCCGCTCCCGG - Exonic
937259586 2:120576901-120576923 GCGCACTGCGACACCGCTGCAGG - Intergenic
938583708 2:132669841-132669863 GCGCACCTGGCCTCGGCTGCTGG + Intronic
942565906 2:177264624-177264646 CCGCGCCGCGCCTCGGCAGCCGG - Exonic
948527340 2:238579752-238579774 GCACGCCCTGCCTCCTCTGCCGG - Intergenic
949004291 2:241636828-241636850 GGGCGCCGGGCCTCGGCGGCCGG - Intronic
1169488387 20:6052322-6052344 GCTCGCCGGGAATCCGCTGCGGG - Exonic
1173672903 20:44810395-44810417 CCGGGCCGAGGCTCCGCTGCGGG + Intergenic
1175902956 20:62367173-62367195 GGGCCCCGCGCCGCTGCTGCTGG - Exonic
1176242929 20:64083479-64083501 TCTCCACGCGCCTCCGCTGCCGG + Exonic
1179633496 21:42692877-42692899 TCGCACCGCGGCTCCGGTGCAGG - Intronic
1179809947 21:43864569-43864591 GCGCGCAGCGGCTCCGCGGAAGG - Intergenic
1180460018 22:15553982-15554004 GCGCGCCGCGCCGCCTGAGCCGG + Intergenic
1181085160 22:20436482-20436504 GCGAGCCCCGCCTCCGGGGCGGG - Intronic
1183546046 22:38455325-38455347 GCGCCCCCCACCCCCGCTGCAGG + Intergenic
1183601642 22:38843675-38843697 GCGCGCTCAGGCTCCGCTGCGGG + Exonic
1184247584 22:43243448-43243470 GAGCGCCCGGCCTCCCCTGCAGG - Intronic
1184593914 22:45502991-45503013 GCGCGCCGCGCCGTCGCGCCGGG + Exonic
1184695092 22:46134503-46134525 GCTGGCCGCACCTCCGCTGAGGG - Intergenic
1185314003 22:50170963-50170985 GCGCCCCGCGCCCCGGCCGCCGG - Intronic
1185375620 22:50481578-50481600 CCGGGCCGCGACTCCGCTCCAGG + Exonic
1185393290 22:50574033-50574055 GCGCCCCTCCCCTCCTCTGCCGG + Intronic
951558765 3:23945714-23945736 GCGCGCCGCGTGTCCGCCTCTGG + Intronic
953183227 3:40615698-40615720 GCGCCCCGCGCGCCTGCTGCAGG + Intergenic
954028710 3:47803110-47803132 AGGGGCCGCGCCGCCGCTGCTGG + Exonic
954031763 3:47824948-47824970 GAGCGCCGCGCGCCCCCTGCGGG - Intronic
954778848 3:53045286-53045308 GCGCGCCCGGCCCCAGCTGCGGG + Intronic
955996668 3:64686194-64686216 GCGCTCAGCGGCTCCGCTCCCGG + Intronic
961073568 3:123961266-123961288 GCCCGCCGAGCTTCCGCTTCCGG + Exonic
963038435 3:141051596-141051618 ACGGGCCGCGCCTCGGCCGCTGG - Exonic
968491662 4:893489-893511 GCGCGCTGTGCTTCTGCTGCAGG - Exonic
968631542 4:1654637-1654659 CCGCCCCCCGCCTCAGCTGCTGG - Intronic
968804572 4:2763967-2763989 GCGCGCCCCGCTTTCGCTGGCGG - Intergenic
968835794 4:2963579-2963601 GCGCCCCTCGCCGCCGCGGCCGG - Intergenic
968887072 4:3340798-3340820 GCACGCCGTGCCTCCGAGGCTGG - Intronic
975041055 4:69744283-69744305 GGCCGCTGCGCCTCCGCTGAGGG - Intronic
975701913 4:77075424-77075446 GCTCGACGCGTCTCCGCGGCCGG - Intronic
979455637 4:120922834-120922856 GCCCCCCGCGCCCCCGCAGCAGG - Exonic
979624277 4:122827596-122827618 GCGCGCCGCGGCTCCGGGCCGGG - Intronic
981331346 4:143513773-143513795 CTGCGCCGCGCCTCCGCGACGGG - Exonic
985782151 5:1876912-1876934 GCGAGCCGCGGCTCCGCGGGGGG - Intergenic
986336933 5:6762383-6762405 GCGTGCTGTGCCTCCCCTGCGGG + Intergenic
987193242 5:15500354-15500376 GCTCACCGCGCCGCCGCCGCCGG - Exonic
987355880 5:17062478-17062500 CCGCTCCGCTCCTGCGCTGCGGG + Intergenic
990954743 5:61331288-61331310 GCGCGACCCGCGTCCGGTGCCGG - Intergenic
991371621 5:65925724-65925746 GCGCGCCGCGACTCTGCGGCGGG - Intergenic
992473142 5:77077368-77077390 GCGCCCTCCGCCTCCGCTCCAGG + Exonic
1002638916 5:180621379-180621401 GCGCGGCGCGCCTCCGCAGGGGG + Intronic
1003049232 6:2765352-2765374 GCGCGAGGCGCCTCCGCCGCCGG + Intergenic
1005725130 6:28640241-28640263 GCTCTCGGCGCCTCCTCTGCCGG - Intergenic
1005926788 6:30451547-30451569 GCCAGCCGCGCCTCCGGTCCAGG + Intergenic
1007431574 6:41780109-41780131 CCGCGCCCCGCCTCCGCCGCAGG - Intronic
1011099980 6:83709351-83709373 CCGGGCCGCCCCTCCGCTGCTGG + Exonic
1011128737 6:84033708-84033730 CCCCGCGCCGCCTCCGCTGCGGG + Intergenic
1011983964 6:93419141-93419163 GCCGGCCGCGCCTCCGGCGCCGG - Intronic
1017696498 6:157021382-157021404 TCGCCCAGCGCCTCCGCGGCAGG - Intronic
1017793634 6:157823068-157823090 CCGCGCCGCGCCGCCGCCCCGGG - Intronic
1017842317 6:158232103-158232125 GCGAGCGGCGCCTCCCCGGCCGG - Intergenic
1020105793 7:5421718-5421740 GCGCAGCGCGCCACCGCCGCCGG - Intronic
1020224942 7:6272542-6272564 GCCCGCGGCCCCTCTGCTGCCGG - Exonic
1025615418 7:63113202-63113224 GCGCTGCGCGGCTCCGATGCGGG - Intergenic
1026765005 7:73154883-73154905 GCGGGCCGCGCATGCGCAGCGGG + Intergenic
1027041479 7:74964640-74964662 GCGGGCCGCGCATGCGCAGCGGG + Intergenic
1027082163 7:75237729-75237751 GCGGGCCGCGCATGCGCAGCGGG - Intergenic
1029168915 7:98617380-98617402 GCGGGAGGCGCCTTCGCTGCTGG - Exonic
1029701290 7:102248495-102248517 GGGCGCCGCCCGGCCGCTGCGGG - Exonic
1030227465 7:107169150-107169172 GCGGCCCGCGCCTGGGCTGCCGG + Exonic
1031629963 7:124033394-124033416 TAGCCCCGCGCCTCCGCTGCAGG + Intergenic
1032279957 7:130492213-130492235 GCGGGCTGCGCCCCCGCTGCTGG + Exonic
1033288570 7:140062560-140062582 GCGCGCAGCTCCACCTCTGCAGG - Exonic
1034306673 7:150049167-150049189 GGGCTCCGCTCCTCCGCTCCAGG + Intergenic
1034445935 7:151114526-151114548 CCGCGCCGCGCCGCCGTTCCCGG + Intronic
1034800172 7:154051476-154051498 GGGCTCCGCTCCTCCGCTCCAGG - Intronic
1035018598 7:155787512-155787534 CCGCGCCGCCCGCCCGCTGCAGG + Intergenic
1040076977 8:43246690-43246712 CCGCCCCGCTCCTCCGCCGCAGG - Intergenic
1044988587 8:97775922-97775944 GCCCGCCGCGCCGCTGCTGCCGG - Exonic
1047381983 8:124372458-124372480 CCGCGCCGCTCCTCCTCAGCCGG - Exonic
1049189399 8:141278556-141278578 GCCCGCCCCACCTCCACTGCAGG - Intronic
1049801645 8:144520480-144520502 GCCCGCTGCGGCTCTGCTGCCGG + Exonic
1051206310 9:14693107-14693129 GCCCGCCGCTCCTCCGCGCCGGG - Intronic
1053381255 9:37651073-37651095 GCGGGCGGCACCTCCTCTGCAGG + Intronic
1054775792 9:69122328-69122350 GCCCGCTGAGCCTCCGCCGCGGG + Intronic
1055632248 9:78236303-78236325 GCGGGCGGCGTCTCCGCGGCGGG + Exonic
1056126231 9:83538383-83538405 GCCCGCCGCGCCCCGGCCGCTGG - Exonic
1058053329 9:100427372-100427394 GGCTGCCGCGCCGCCGCTGCAGG + Intronic
1060479279 9:124008646-124008668 GCGCGCGGCAGCTCCGCAGCCGG + Intronic
1060695746 9:125707349-125707371 GCGCGCCGCTTCTCCAGTGCAGG + Intergenic
1062545835 9:137063464-137063486 GGGCGCAGGGCCTCCGATGCGGG - Exonic
1062549288 9:137078480-137078502 GCTCACCGCGCCTCCCTTGCAGG + Exonic
1062696287 9:137877873-137877895 GCGCCCCGCGCCCTCCCTGCCGG + Exonic
1187900910 X:24025760-24025782 GCGCCCCGCGTCCCGGCTGCCGG + Intronic
1190911538 X:54776079-54776101 GCCCACCGTGCCTCAGCTGCTGG - Intronic
1200107811 X:153724505-153724527 GAGCGCCGGCCCTCCGCTCCGGG - Intronic