ID: 1084275635

View in Genome Browser
Species Human (GRCh38)
Location 11:68049749-68049771
Sequence TCCTCCGCAGGCGGCGGCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 2, 2: 7, 3: 76, 4: 434}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084275635_1084275655 22 Left 1084275635 11:68049749-68049771 CCACCGCCGCCGCCTGCGGAGGA 0: 1
1: 2
2: 7
3: 76
4: 434
Right 1084275655 11:68049794-68049816 ACCGGGGCCTAAGGTGTGGGGGG 0: 1
1: 0
2: 0
3: 10
4: 279
1084275635_1084275642 -2 Left 1084275635 11:68049749-68049771 CCACCGCCGCCGCCTGCGGAGGA 0: 1
1: 2
2: 7
3: 76
4: 434
Right 1084275642 11:68049770-68049792 GAGGCCCGCTGACCGACAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 61
1084275635_1084275653 20 Left 1084275635 11:68049749-68049771 CCACCGCCGCCGCCTGCGGAGGA 0: 1
1: 2
2: 7
3: 76
4: 434
Right 1084275653 11:68049792-68049814 GGACCGGGGCCTAAGGTGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 143
1084275635_1084275646 4 Left 1084275635 11:68049749-68049771 CCACCGCCGCCGCCTGCGGAGGA 0: 1
1: 2
2: 7
3: 76
4: 434
Right 1084275646 11:68049776-68049798 CGCTGACCGACAGGTGGGACCGG 0: 1
1: 0
2: 0
3: 5
4: 58
1084275635_1084275641 -5 Left 1084275635 11:68049749-68049771 CCACCGCCGCCGCCTGCGGAGGA 0: 1
1: 2
2: 7
3: 76
4: 434
Right 1084275641 11:68049767-68049789 GAGGAGGCCCGCTGACCGACAGG 0: 1
1: 0
2: 0
3: 6
4: 64
1084275635_1084275652 19 Left 1084275635 11:68049749-68049771 CCACCGCCGCCGCCTGCGGAGGA 0: 1
1: 2
2: 7
3: 76
4: 434
Right 1084275652 11:68049791-68049813 GGGACCGGGGCCTAAGGTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 106
1084275635_1084275647 5 Left 1084275635 11:68049749-68049771 CCACCGCCGCCGCCTGCGGAGGA 0: 1
1: 2
2: 7
3: 76
4: 434
Right 1084275647 11:68049777-68049799 GCTGACCGACAGGTGGGACCGGG 0: 1
1: 0
2: 0
3: 12
4: 113
1084275635_1084275650 13 Left 1084275635 11:68049749-68049771 CCACCGCCGCCGCCTGCGGAGGA 0: 1
1: 2
2: 7
3: 76
4: 434
Right 1084275650 11:68049785-68049807 ACAGGTGGGACCGGGGCCTAAGG 0: 1
1: 0
2: 1
3: 12
4: 144
1084275635_1084275643 -1 Left 1084275635 11:68049749-68049771 CCACCGCCGCCGCCTGCGGAGGA 0: 1
1: 2
2: 7
3: 76
4: 434
Right 1084275643 11:68049771-68049793 AGGCCCGCTGACCGACAGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 39
1084275635_1084275651 18 Left 1084275635 11:68049749-68049771 CCACCGCCGCCGCCTGCGGAGGA 0: 1
1: 2
2: 7
3: 76
4: 434
Right 1084275651 11:68049790-68049812 TGGGACCGGGGCCTAAGGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 147
1084275635_1084275654 21 Left 1084275635 11:68049749-68049771 CCACCGCCGCCGCCTGCGGAGGA 0: 1
1: 2
2: 7
3: 76
4: 434
Right 1084275654 11:68049793-68049815 GACCGGGGCCTAAGGTGTGGGGG 0: 1
1: 0
2: 0
3: 7
4: 189
1084275635_1084275648 6 Left 1084275635 11:68049749-68049771 CCACCGCCGCCGCCTGCGGAGGA 0: 1
1: 2
2: 7
3: 76
4: 434
Right 1084275648 11:68049778-68049800 CTGACCGACAGGTGGGACCGGGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084275635 Original CRISPR TCCTCCGCAGGCGGCGGCGG TGG (reversed) Exonic