ID: 1084275683

View in Genome Browser
Species Human (GRCh38)
Location 11:68049901-68049923
Sequence GCGGGTGGTGGGGGACCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 310}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084275666_1084275683 27 Left 1084275666 11:68049851-68049873 CCTGACTCCTCGCTTCCTGACAG 0: 1
1: 0
2: 0
3: 19
4: 156
Right 1084275683 11:68049901-68049923 GCGGGTGGTGGGGGACCTCCTGG 0: 1
1: 0
2: 1
3: 28
4: 310
1084275667_1084275683 20 Left 1084275667 11:68049858-68049880 CCTCGCTTCCTGACAGACTCCTG 0: 1
1: 0
2: 0
3: 23
4: 258
Right 1084275683 11:68049901-68049923 GCGGGTGGTGGGGGACCTCCTGG 0: 1
1: 0
2: 1
3: 28
4: 310
1084275676_1084275683 -8 Left 1084275676 11:68049886-68049908 CCAGGAGCAGGCCTGGCGGGTGG 0: 1
1: 0
2: 3
3: 46
4: 367
Right 1084275683 11:68049901-68049923 GCGGGTGGTGGGGGACCTCCTGG 0: 1
1: 0
2: 1
3: 28
4: 310
1084275669_1084275683 12 Left 1084275669 11:68049866-68049888 CCTGACAGACTCCTGAGTGGCCA 0: 1
1: 0
2: 0
3: 20
4: 182
Right 1084275683 11:68049901-68049923 GCGGGTGGTGGGGGACCTCCTGG 0: 1
1: 0
2: 1
3: 28
4: 310
1084275672_1084275683 1 Left 1084275672 11:68049877-68049899 CCTGAGTGGCCAGGAGCAGGCCT 0: 1
1: 0
2: 2
3: 30
4: 311
Right 1084275683 11:68049901-68049923 GCGGGTGGTGGGGGACCTCCTGG 0: 1
1: 0
2: 1
3: 28
4: 310
1084275665_1084275683 28 Left 1084275665 11:68049850-68049872 CCCTGACTCCTCGCTTCCTGACA 0: 1
1: 0
2: 1
3: 21
4: 234
Right 1084275683 11:68049901-68049923 GCGGGTGGTGGGGGACCTCCTGG 0: 1
1: 0
2: 1
3: 28
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084275683 Original CRISPR GCGGGTGGTGGGGGACCTCC TGG Intronic
900188509 1:1343752-1343774 GAGGGTGGTGGGCGGCCTCTGGG - Intronic
900370500 1:2329973-2329995 CCGGGTGAGGGGGGAGCTCCGGG + Intronic
901211042 1:7526298-7526320 GTGGGCGGTGGGGGAGCTCGGGG - Intronic
901225695 1:7611794-7611816 GCCAGTGCTGGGGGACCGCCTGG + Intronic
902502537 1:16920689-16920711 GGAGGTGGTGGGTGACCTCTGGG + Intronic
902865228 1:19273615-19273637 GAGGGTGCTGGGCTACCTCCCGG + Intergenic
903231973 1:21927519-21927541 GGGGGGGGTGGGGGATGTCCTGG - Intronic
903703250 1:25266754-25266776 GAGGGTGGAGGGGGAGATCCAGG - Intronic
904034809 1:27552869-27552891 GTGAGTGGTGGGGGTTCTCCTGG - Intronic
904101414 1:28032016-28032038 CCTGGGGGTGGGGGACCGCCAGG - Intronic
904591503 1:31617884-31617906 GCGGGGTGTGGGGGACCCCCAGG + Exonic
905271572 1:36790933-36790955 GAGGGGGGTGGGGGACCTGTGGG + Intergenic
905286000 1:36880781-36880803 GCTGGATGTGGGGCACCTCCAGG + Exonic
906107485 1:43303699-43303721 GCAGGTGGAGGGGGCTCTCCAGG - Intronic
906220121 1:44071897-44071919 GGGGGTGGAGGGGAAGCTCCAGG - Intergenic
906460237 1:46030954-46030976 GCAGGAGGAGGGGGACCACCTGG + Intronic
907403678 1:54240931-54240953 CCTGGTGGTGGCGGTCCTCCAGG - Exonic
910216837 1:84851908-84851930 GCTGGTGGTGGGGGAAGGCCTGG + Intronic
915247988 1:154569487-154569509 GCGGCTGGTGGAGCATCTCCTGG + Exonic
915510093 1:156382133-156382155 GGGGGTCCTGGGGGCCCTCCTGG + Exonic
915675325 1:157524489-157524511 GGCTGTGGTGGGGGACCTGCTGG - Exonic
915675691 1:157527827-157527849 GGCTGTGGTGGGGGACCTGCTGG - Exonic
915690982 1:157690465-157690487 GGCTGTGGTGGGGGACCTGCTGG - Exonic
915835493 1:159172361-159172383 GCGGGTGGTGGGGGACGGGCGGG - Intronic
915915845 1:159940435-159940457 GCAGGTGGAGGGAGGCCTCCAGG - Intronic
919761693 1:201102170-201102192 GGGGGAGGAGGGGGTCCTCCTGG + Intronic
920609735 1:207424738-207424760 CCTGGGGGTGGGGGACCTTCAGG - Intergenic
921367041 1:214383784-214383806 GAGGGAGCTGGGGGACCTCGTGG + Exonic
922062325 1:222104410-222104432 GTGGGTCCTGGTGGACCTCCTGG - Intergenic
923333572 1:232947580-232947602 GCTGGGCGTGGGGGACATCCAGG + Intergenic
924233986 1:241985398-241985420 GTGGGTGGTGGGGGTGGTCCAGG - Intergenic
1062817433 10:510877-510899 GCTGGTGGTGTGGGACAGCCAGG + Intronic
1063647978 10:7904898-7904920 GCGGGTGGTGGAGGAAGTGCGGG - Intronic
1065019611 10:21493984-21494006 GGGGGTGTTGGGGGCCCTCCGGG - Exonic
1069642380 10:69964148-69964170 GCTGGGGGTGGGGGATGTCCTGG + Intronic
1069774910 10:70920689-70920711 GCAGGTGGTGGGGGAGGTGCTGG - Intergenic
1069800507 10:71078824-71078846 GAGGTTGCTGAGGGACCTCCAGG - Intergenic
1069839003 10:71327694-71327716 GTGGGGGGTGGGGAATCTCCAGG - Intronic
1070233901 10:74603402-74603424 TCGGGGGGTGGGGGAGCTCAGGG - Intronic
1071573030 10:86708342-86708364 GCGGGAGGTGGGGGAGCCCATGG + Intronic
1073146151 10:101283148-101283170 GAGGAGGGTGGGGGACTTCCAGG + Intergenic
1074060535 10:109961598-109961620 GAGCGTGGTTGGTGACCTCCTGG - Intergenic
1075090864 10:119443665-119443687 GCGGGAGGAGGTGGACCGCCGGG + Exonic
1075266816 10:121007580-121007602 GGGGGTGGTGGGGGAGCTCCCGG + Intergenic
1077063440 11:627336-627358 GCTGGGGGAGGGGGACGTCCCGG + Intergenic
1077217409 11:1400728-1400750 GCAGGTAGTGGAGGACCTGCCGG + Intronic
1077886879 11:6393342-6393364 GTGGCTGGTGGGGGAGCTTCAGG + Exonic
1078050692 11:7962739-7962761 ATGGGTGGTGTGGGACCTCATGG - Intronic
1080655190 11:34252814-34252836 GAGGAGGCTGGGGGACCTCCTGG + Intronic
1083052962 11:59793247-59793269 GCAGGTGGAGGGGGAGCTGCAGG + Intronic
1083968404 11:66057334-66057356 GGGGGCGGTGGGGGACCACGAGG - Exonic
1084275683 11:68049901-68049923 GCGGGTGGTGGGGGACCTCCTGG + Intronic
1084326990 11:68406230-68406252 GGGGGTGGTGGGAGAACACCTGG - Intronic
1084423095 11:69070646-69070668 GCTGTTGGTGGGGGATCTCTGGG - Intronic
1084423134 11:69070759-69070781 GCTGTTGGTGGGGGATCTCTGGG - Intronic
1084423222 11:69071012-69071034 GCTGTTGGTGGGGGATCCCCGGG - Intronic
1087829188 11:102800345-102800367 GCGGGTTGTGGGGGACTCCAAGG - Intergenic
1089636761 11:119819256-119819278 TCGGGTGTTGGGGGCCCTCCTGG + Intergenic
1089710603 11:120311756-120311778 GCAGGTGGTGGGTGAAATCCTGG + Intronic
1089741798 11:120589691-120589713 GCGGGTGGTGAGAGACCTGAGGG - Intronic
1090831148 11:130421724-130421746 GGGTGAGGTGGGGGACCTCAGGG + Intronic
1091074919 11:132606539-132606561 GGGGGTGGTGGCAGCCCTCCTGG - Intronic
1092712424 12:11353207-11353229 GCTGGAGGTGGGGGACCTTGAGG + Exonic
1092716160 12:11392927-11392949 GCTGGAGGTGGGGGACCTTGAGG + Exonic
1096345352 12:50841631-50841653 TCGGGTAGTGGGGAACCACCAGG - Intergenic
1099650979 12:85427989-85428011 GCGGTGGGTGGGGGAACACCAGG - Intergenic
1099713863 12:86265088-86265110 TCGGGGGGTGGGGCAGCTCCAGG - Intronic
1100819767 12:98420264-98420286 CCTGGGGGTGGGGGACCTGCAGG + Intergenic
1101131743 12:101697628-101697650 GCGGGTGGGGCGGGGCCTCGGGG - Exonic
1101891062 12:108715774-108715796 GCGGTTGGTGTGAGACCTCTTGG - Intronic
1102006261 12:109590964-109590986 GTGGGTGGTGGGGGCCCTTAGGG + Intronic
1103530582 12:121598438-121598460 GCAGGTGATGTAGGACCTCCTGG + Intergenic
1104690133 12:130819187-130819209 GAGGTTGACGGGGGACCTCCGGG + Intronic
1104931422 12:132341311-132341333 GAGGGTGGGGGAGGACCTGCTGG + Intergenic
1104990508 12:132621566-132621588 GCGGGTGCGGGGGGTCCACCAGG + Exonic
1105892300 13:24690388-24690410 GCTGGTGGTGGGGGACATTGTGG + Exonic
1107601225 13:42014447-42014469 GTGAGTGGGGTGGGACCTCCAGG + Intergenic
1108334789 13:49428518-49428540 GCAGGTGGTGGGGGCCATCTTGG + Intronic
1114037677 14:18645378-18645400 CCTGGTGGTGGTGGCCCTCCAGG - Intergenic
1114120957 14:19669645-19669667 CCTGGTGGTGGCGGCCCTCCAGG + Intergenic
1118239840 14:64045443-64045465 TCGGGGGGTGGGGGTCCTCTAGG + Intronic
1119808695 14:77499003-77499025 GAGGAGGGTGGGGGACGTCCAGG - Intergenic
1120483502 14:85082307-85082329 GTGGGTGGTGGGGGAGGTCAGGG - Intergenic
1121588207 14:95078617-95078639 GCGGGGTGGGGGGGATCTCCTGG - Intergenic
1121634285 14:95443208-95443230 GCTGGTGGTTGGGGTTCTCCTGG + Exonic
1122623027 14:103070536-103070558 GCGGGAGGTGGGGGGCCATCTGG + Intergenic
1122829445 14:104388629-104388651 GCTGGGGGCGGGGGCCCTCCTGG + Intergenic
1122855637 14:104558800-104558822 CCGGGAGGTGGGGGACCACTGGG + Intronic
1123696046 15:22880017-22880039 GCTGGTGGTGGAAGAACTCCAGG + Exonic
1123716010 15:23032299-23032321 GCGGAGGGTGGTGTACCTCCTGG - Intronic
1124884483 15:33672154-33672176 GCGGGGGGTGGGGTCCCACCAGG + Intronic
1126726574 15:51637996-51638018 GCGTGTGGTGGGGGAAGTCAAGG - Intergenic
1126953745 15:53911215-53911237 CCTGGGGGTGGGGGACCTCCAGG + Intergenic
1127267903 15:57376311-57376333 GCGGGTGGTGCGGGGGTTCCTGG + Intronic
1128067801 15:64775424-64775446 GCGGGTGGCGGGGGACCCACGGG + Exonic
1128782941 15:70374971-70374993 GGGGGTGTTGCGGGACCTCTGGG - Intergenic
1129150985 15:73687643-73687665 GAGGGTGGAGGGGGAACTCCTGG - Intronic
1132426712 15:101724213-101724235 GCGGGAGGTGGCGCAGCTCCGGG - Exonic
1132663561 16:1071938-1071960 GAGGGGGCTGGGGGACCTCCTGG + Intergenic
1132851658 16:2027393-2027415 GGGGGTGGGGGGGGGCATCCTGG + Intronic
1133706930 16:8363688-8363710 GGAGGAGGTGCGGGACCTCCAGG - Intergenic
1136003603 16:27313960-27313982 GCGGGAAGTGGGGGACCCCTGGG - Exonic
1136281274 16:29212945-29212967 GAAGGTGGTGGGCGGCCTCCAGG - Intergenic
1136627683 16:31472109-31472131 GCGGGGGGCGGGGGACGTCCGGG - Exonic
1136707086 16:32200280-32200302 CAGGGTGTGGGGGGACCTCCTGG - Intergenic
1136760824 16:32729137-32729159 CAGGGTGTGGGGGGACCTCCTGG + Intergenic
1136807279 16:33141249-33141271 CAGGGTGTGGGGGGACCTCCTGG - Intergenic
1137488772 16:48913499-48913521 GAAGGGCGTGGGGGACCTCCAGG - Intergenic
1137542692 16:49376113-49376135 GCAGGTGATGGGGGACCCTCTGG + Intronic
1140047863 16:71454506-71454528 GGGAGTGGTGTGGGACCTGCTGG - Intronic
1141955842 16:87370740-87370762 GCGAGTGCTGAGGGACCTGCTGG + Intronic
1142085643 16:88178873-88178895 GAAGGTGGTGGGCGGCCTCCAGG - Intergenic
1142147902 16:88500123-88500145 GCTGGTGGTGGGGGATGGCCGGG - Intronic
1142230761 16:88899254-88899276 GTGGGTGGTGGGTGCCCTTCAGG - Intronic
1142352251 16:89585828-89585850 GGGGGTGGAGGGGGGCCTTCGGG + Intronic
1203062976 16_KI270728v1_random:989451-989473 CAGGGTGTGGGGGGACCTCCTGG + Intergenic
1142690636 17:1604508-1604530 CCGGGGGGTGAGGGACCCCCAGG - Intronic
1142762679 17:2051028-2051050 GCGGGTGGGGCGGCCCCTCCGGG - Intergenic
1143011251 17:3867377-3867399 GCGGGTGGTGGGGCACAGGCTGG + Intronic
1143188093 17:5022562-5022584 GGCGGAGGTGGAGGACCTCCGGG + Exonic
1143521547 17:7446982-7447004 TCGGGGGGCGGGGGGCCTCCGGG + Intronic
1144724289 17:17493938-17493960 GCGGGTGGTGGGGGCGCGCCAGG + Intergenic
1144846807 17:18224551-18224573 GTGGGTGGAGGGGGACAGCCAGG + Intergenic
1144955798 17:19018235-19018257 GTGGGTGGTGGGTGACCCGCTGG - Intronic
1147159407 17:38561688-38561710 TGCGGTGGCGGGGGACCTCCGGG + Exonic
1147567410 17:41546247-41546269 GGGGCTGGCGGGGGGCCTCCTGG - Intergenic
1147885055 17:43678795-43678817 GGGTGTGGGGTGGGACCTCCAGG + Intergenic
1148108877 17:45133278-45133300 GCGCGAAGTGGGGGACGTCCAGG + Intronic
1148578158 17:48725645-48725667 GCTGGGGGTGGGGGGCCTGCCGG - Exonic
1148849851 17:50549261-50549283 GCGGGAGGTGGGGGCACACCTGG - Intronic
1148863710 17:50617934-50617956 CCGGGAGGTGGGGGGCCTCTGGG + Intronic
1149373333 17:56018601-56018623 GCGGGTGCTGGGGGAAGCCCTGG + Intergenic
1149678523 17:58487830-58487852 GCGGGCGGCAGGGCACCTCCAGG + Exonic
1151231939 17:72691099-72691121 ACTAGGGGTGGGGGACCTCCTGG + Intronic
1152238871 17:79151662-79151684 GAGGGTGGGAGGGGACCTGCAGG + Intronic
1152238948 17:79151843-79151865 GAGGGTGGGAGGGGACCTGCAGG + Intronic
1153520901 18:5953102-5953124 CTGAGTGGTGGGGGTCCTCCTGG + Intergenic
1154163089 18:11994508-11994530 GCGGGTGCTGGGGGCCCTTGGGG - Intronic
1154171768 18:12057467-12057489 GGTGGAGGTGGAGGACCTCCAGG - Intergenic
1156522140 18:37730796-37730818 GGGGGTGCGGGGGGAGCTCCAGG + Intergenic
1156690416 18:39700618-39700640 GGGGGTGGTGGGGAACCACCAGG + Intergenic
1157546972 18:48553452-48553474 GCGGGTGATGGGGTAATTCCCGG + Intronic
1157610688 18:48952937-48952959 GCGGGTGGCGGAGGTCTTCCGGG - Intergenic
1159005373 18:63005595-63005617 GCAGGGGTTGGGGGAGCTCCAGG + Intergenic
1160062589 18:75546479-75546501 GGGGGTAGGTGGGGACCTCCAGG + Intergenic
1160452985 18:78978591-78978613 GCTGGTGGCGGGGGTCCGCCTGG - Intergenic
1160670368 19:359690-359712 GCTGGTGACGGGGGCCCTCCTGG + Intergenic
1160798675 19:957118-957140 GGGGGCGCTGGGGGACCTCCTGG + Intronic
1160809954 19:1009022-1009044 GGGGTGGGCGGGGGACCTCCGGG - Intronic
1160819122 19:1049713-1049735 GGGAGTGGTGGGGGGCCTCACGG - Intronic
1160944295 19:1634025-1634047 TGGTGTGGTGGGGGACCTCCTGG + Intronic
1161236739 19:3201950-3201972 GCTGGGGGTGGGGGCCGTCCTGG + Intronic
1161267114 19:3369511-3369533 GCGGGGGGTGGGGGGCATCTCGG + Intronic
1161286043 19:3468850-3468872 GGGGAGGGTGGGGGACCTGCTGG - Intronic
1161615776 19:5269460-5269482 GCAGTTGGTGGGGGACCATCTGG - Intronic
1161811007 19:6471366-6471388 GCGGGTAGTGGGGGACCCAGGGG + Intronic
1162132662 19:8536666-8536688 GCTGGAGGTGGGGGACCTGGGGG + Intronic
1162345506 19:10115922-10115944 GCTGGTGGGTGGGCACCTCCCGG - Intronic
1162480023 19:10922454-10922476 GGGGGCGGGGGGGGACCTGCAGG - Exonic
1162973128 19:14193177-14193199 GCAGGTGGTGGGTGTCCCCCGGG + Intronic
1163628017 19:18402054-18402076 GCAGGTGGTGGGGGACAGGCAGG + Intergenic
1163676128 19:18656170-18656192 GGGGTTGGTGGGGGACCTGCAGG + Intronic
1164137659 19:22428402-22428424 GCGGGTGGGGAGGGACCAGCGGG - Intronic
1165022459 19:32935843-32935865 GTGGGTGGTGGGGGCCTTCTTGG - Intronic
1165040487 19:33064747-33064769 GCGGGCGGGCGGGGACCTGCGGG - Intronic
1165141737 19:33703958-33703980 GTGGGGGGTGGAGGAGCTCCTGG + Intronic
1165392837 19:35548252-35548274 GAGGGTGGAGGGGGGCATCCAGG - Intergenic
1165433901 19:35786724-35786746 GCGGGAGGTGCGGGATCCCCTGG - Intronic
1165758142 19:38305771-38305793 GCGGGTGAAGGGGGACTTCCCGG + Intronic
1166812423 19:45522396-45522418 GGGGGTGGGGGGGGACCTGGAGG - Exonic
1166895325 19:46018890-46018912 GTGGGTCCTGGGGGTCCTCCTGG - Intronic
1167259470 19:48450396-48450418 GCAGGTGGTGGAGGAGCCCCAGG + Exonic
1167381277 19:49139722-49139744 GTGGGTGGTGGGGTGTCTCCTGG - Exonic
1168318390 19:55494150-55494172 GCTGGGGGTGGGGGTGCTCCTGG + Intronic
1168344811 19:55644986-55645008 GCGGGTGGTGGGCGGCCCCACGG + Exonic
1168381395 19:55926712-55926734 GAGGGTGGTGGGGGAAATCTTGG + Intronic
925047617 2:785985-786007 GCGGGAGGTGGGAGAGCTACAGG + Intergenic
925188946 2:1867622-1867644 TCTGGGGGTGGGGGACCTCGGGG + Intronic
925376116 2:3387659-3387681 GAGGGGGGTGCGGGGCCTCCGGG - Exonic
927690502 2:25204659-25204681 GCGGGCGTCCGGGGACCTCCTGG - Intergenic
927702643 2:25277528-25277550 GCGGGGAGTGGAGGACCCCCGGG + Intronic
927809191 2:26172716-26172738 GCGGGTGATGGAGGACCCCAGGG - Intergenic
928845429 2:35666195-35666217 GGAGGTGGGGGGGGACCTCGTGG + Intergenic
929201712 2:39243833-39243855 GCCGGTGGCGGGGGAACTGCGGG - Intergenic
931052325 2:58428539-58428561 GGGGATGGTGGGGGTGCTCCGGG - Intergenic
932142875 2:69294989-69295011 GCTGGGGGTGGCGGACCTCGAGG + Intergenic
932931560 2:76046056-76046078 GTCGGTGGTGGGGGGCCTGCTGG + Intergenic
934242250 2:90280261-90280283 GCGGGGGGGGGGAGACATCCAGG - Intergenic
934659291 2:96134605-96134627 GCAGGTGGTGTGCGACCACCCGG - Intronic
935016817 2:99190758-99190780 GCGAGTGGAGGGAGACCACCAGG + Intronic
935791264 2:106592262-106592284 GCAGGTGCTGGGGGAGCTGCAGG + Intergenic
937183026 2:120013064-120013086 GCGGGAGGTCGGGGTCCTCCGGG + Exonic
937419239 2:121740770-121740792 GCAGGTCCTGGAGGACCTCCGGG + Intronic
937862109 2:126719288-126719310 GCTGGTGGTGGGGGGACGCCTGG - Intergenic
938273296 2:129993685-129993707 CCTGGTGGTGGCGGCCCTCCAGG + Intergenic
938442924 2:131352416-131352438 CCTGGTGGTGGCGGCCCTCCAGG - Intronic
938969047 2:136415321-136415343 GAGGATGGTGGGGGAGCTCCAGG + Intergenic
942279260 2:174343920-174343942 TCGGGTGTTGGGCGGCCTCCTGG + Intergenic
943314115 2:186364634-186364656 GGGGGTGGTGGGGGACCCAGTGG - Intergenic
946010250 2:216558705-216558727 GCTGGTGGTGGAGTAGCTCCTGG - Intronic
946411731 2:219518576-219518598 GCTGGGGGTGGGGGACATACAGG - Intronic
948468294 2:238162539-238162561 GCTGGAGGTGGGGGCCCTCGGGG - Intronic
1175188977 20:57198681-57198703 ACGGGTGGTGGGGGGTCTCGAGG - Intronic
1175911468 20:62407209-62407231 GCGGGTGGCGGGGGCCCGGCGGG + Exonic
1176221090 20:63969691-63969713 GCGGGGGGCGGGGGGGCTCCGGG + Intronic
1180109372 21:45640959-45640981 CCGGGTGCTGGGAGACTTCCTGG + Intergenic
1180222780 21:46369972-46369994 GGGGGTGCTGGGGGAGCTACAGG + Intronic
1180461806 22:15572420-15572442 CCTGGTGGTGGTGGCCCTCCAGG - Intergenic
1180832914 22:18915173-18915195 GTGGGTGGTTGGGGAGCTCTGGG - Intronic
1181809653 22:25395643-25395665 CCGGGTGCTGGGTGCCCTCCAGG - Intronic
1182804484 22:33058465-33058487 GCGGGTGGGCGGGGCCGTCCGGG - Intergenic
1183149843 22:36028747-36028769 GCGGCCGGTGGGCGAGCTCCGGG - Intergenic
1183489722 22:38109905-38109927 GTGGGTGGTGTGAGGCCTCCAGG + Intronic
1183745892 22:39691443-39691465 GCTGGGGGTGGGGGTCTTCCTGG + Intergenic
1184059737 22:42074527-42074549 GCTGGGGGTGCGGGACCGCCGGG - Intronic
1184072518 22:42154788-42154810 GCTGGTGGTGGGGGATCCTCAGG + Intergenic
1184212074 22:43041999-43042021 CTGGGTGGGGGGGGTCCTCCAGG + Intronic
1185337329 22:50276498-50276520 GAGGGTGGGGCGGGACCTCGAGG - Intronic
1185338418 22:50281049-50281071 GCTGGTGCTGGGGCGCCTCCTGG - Intronic
1185348166 22:50319647-50319669 GCGGGTGGTGAGGGAGCTGGAGG - Intronic
949702679 3:6777175-6777197 GCTGGTGGAGGGAGCCCTCCGGG - Intronic
949842109 3:8331015-8331037 AGGGGTGGTGGTGGACCCCCTGG + Intergenic
950256751 3:11512214-11512236 GAGGGGTGTGGGGGACCTCTGGG - Intronic
950503286 3:13377685-13377707 GTGGGTGGTGTGGGGCCTGCAGG - Intronic
950503301 3:13377729-13377751 GTGGGTGGAGTGGGGCCTCCAGG - Intronic
950503316 3:13377773-13377795 GTGGGTGGAGTGGGGCCTCCAGG - Intronic
950503331 3:13377817-13377839 GTGGGTGGTGTGGGGCCTCCAGG - Intronic
950503339 3:13377839-13377861 GTGGGTGGTGTGGGGCCTGCAGG - Intronic
950503354 3:13377883-13377905 GTGGGTGGTGTGGGGCCTCCAGG - Intronic
950503362 3:13377905-13377927 GTGGGTGGTGTGGGGCCTGCAGG - Intronic
954486902 3:50861133-50861155 CTGGGTGGTGGAGGATCTCCTGG + Intronic
957916680 3:86695349-86695371 GGGGGTGGTGGGTGTCCTCTAGG + Intergenic
958814699 3:98902045-98902067 GCGCGGGATGGGGGACGTCCCGG - Intergenic
961781945 3:129325546-129325568 GTGGGTGGTGTGGGGCCTACAGG - Intergenic
961781960 3:129325590-129325612 GTGGGTGGTGTGGGGCCTCCAGG - Intergenic
963939916 3:151087163-151087185 GGGGGTGCTGGGCGACCCCCCGG + Intronic
966674732 3:182572625-182572647 GCAGGGGGTGGGGGCCCTGCAGG - Intergenic
968505846 4:971196-971218 CAGGGTGGTGGGGGAACTCGAGG - Intronic
968607932 4:1544253-1544275 GCGGGAGGTGAGGGAGCTACGGG + Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968955493 4:3716793-3716815 GCAGTCGGTGGGGGCCCTCCAGG + Intergenic
969166832 4:5323287-5323309 GCTGGTGGAGGGGGACTTGCAGG - Intronic
970281104 4:14456573-14456595 GCTGGAGGTGGGGGACCTGGTGG - Intergenic
976600876 4:86936067-86936089 GCTGGTGGTGGAGAAGCTCCGGG - Intronic
985685578 5:1279949-1279971 GGGGGTGTAGGGGGAGCTCCTGG - Intronic
985758428 5:1732803-1732825 GTGGGTGGGGAGGGACCACCAGG + Intergenic
985973223 5:3393511-3393533 GGGGGTGGGGGAGGCCCTCCTGG + Intergenic
986306560 5:6520861-6520883 GTGTGTGGTGAGGGAGCTCCGGG + Intergenic
986376972 5:7142199-7142221 TGGGGTGGTGGTGGAACTCCAGG - Intergenic
987640967 5:20611868-20611890 GGGCCTGGTTGGGGACCTCCAGG + Intergenic
992886140 5:81162191-81162213 GGGGGTGGTGGGGGACATGGGGG + Intronic
994113738 5:96038516-96038538 GCGGGGGGTGGGGGGGCTACAGG - Intergenic
998083387 5:139294706-139294728 TCGTGTGGTGTGGGACCTTCCGG + Intronic
998583671 5:143404400-143404422 TGCGGTGGTGGGGGACCTGCCGG - Intronic
999652681 5:153783022-153783044 GCTGGAGGTGGGAGACCTGCAGG + Intronic
1000026224 5:157361472-157361494 GCTGGTGGTGGAAGAACTCCAGG - Exonic
1001420286 5:171581209-171581231 GTGGGTGGAGGGGGATGTCCAGG + Intergenic
1001886065 5:175291539-175291561 GCTGGGGGAAGGGGACCTCCAGG - Intergenic
1002060080 5:176620784-176620806 GCTGCTGGTGGGGGCTCTCCTGG + Exonic
1002338955 5:178501883-178501905 GCGGGTGGAGGTGGAAGTCCAGG - Intronic
1002448174 5:179302724-179302746 GAGGGGGGCGGGGGACTTCCTGG + Intronic
1005968501 6:30743455-30743477 TCGGGTGGGGGAGGACGTCCCGG - Exonic
1006417559 6:33913629-33913651 GCGGGTAGAGGGGGATCTCAAGG - Intergenic
1006440083 6:34048458-34048480 GCTGGGGGTGGGGGAACTCTGGG + Intronic
1006640915 6:35489466-35489488 TTGGGTTGAGGGGGACCTCCTGG - Intronic
1006806388 6:36792301-36792323 GCAGGGGGTGGGGCAGCTCCAGG - Intronic
1013308379 6:108871138-108871160 GCTGGTGGTGGAGGACCTGGAGG + Intronic
1018795853 6:167185097-167185119 GGGGGTGGTGGGGGTGCTGCTGG + Intronic
1018820465 6:167369967-167369989 GGGGGTGGTGGGGGTGCTGCTGG - Intronic
1018890114 6:167977008-167977030 GCGGGCGGTGGGGGGGCTTCTGG + Intergenic
1019414201 7:919935-919957 CCGGGTGGGGTGGGGCCTCCCGG - Intronic
1019476568 7:1247371-1247393 GCGCGTGGGGTGGGACCTGCTGG + Intergenic
1019552473 7:1610037-1610059 GCGGGGGGCTGGGGAGCTCCGGG + Intergenic
1020105730 7:5421429-5421451 GCCGGCGGTGGGGCCCCTCCGGG + Exonic
1020116515 7:5479469-5479491 TCGGGTGGTGTGGTGCCTCCTGG - Intronic
1020275655 7:6622995-6623017 GCGGGTGGGGGGTCCCCTCCCGG - Exonic
1021167623 7:17360193-17360215 GCCGGGGGTGGTGGAACTCCGGG - Intergenic
1023406064 7:39834376-39834398 CCCGGTGGTGGCGGCCCTCCAGG + Intergenic
1024964020 7:55005601-55005623 GCGCGGGCTGGGGGGCCTCCGGG - Intergenic
1025236616 7:57239197-57239219 GCGGGTGGGGGGGGGCTTCAGGG - Intergenic
1027263587 7:76481644-76481666 GTGGGAGGTGGGGGTGCTCCTGG + Intronic
1027314959 7:76979756-76979778 GTGGGAGGTGGGGGTGCTCCTGG + Intergenic
1029452439 7:100648695-100648717 GCAGGGGGTGGGGGTGCTCCAGG - Intronic
1029598304 7:101549182-101549204 GGGGGTCCTGGGGGACCTCGAGG - Exonic
1029747754 7:102525774-102525796 GGGGATGGTGGGGGGCCTACTGG - Intergenic
1029765705 7:102624864-102624886 GGGGATGGTGGGGGGCCTACTGG - Intronic
1032506047 7:132435463-132435485 GAGGATGGTGGTGGTCCTCCAGG - Intronic
1033043641 7:137940921-137940943 TGGGGTGGAGGGGTACCTCCTGG - Intronic
1034468271 7:151242486-151242508 ACGGGTGGAGGGGAAGCTCCTGG - Exonic
1035444283 7:158929344-158929366 GCGAGTGGTGGTGGACTTACTGG + Intronic
1036280134 8:7393391-7393413 GTGGGTGGTAGGCCACCTCCTGG - Intergenic
1036283035 8:7417577-7417599 GCGGGTGGTAGGCCACCTCCTGG - Intergenic
1036338434 8:7893942-7893964 GCGGGTGGTAGGCCACCTCCTGG + Intergenic
1036851544 8:12205185-12205207 GCGGGGGGTGGGGAACCTTTAGG + Intergenic
1036872909 8:12447459-12447481 GCGGGGGGTGGGGAACCTTTAGG + Intergenic
1039618221 8:38974090-38974112 GCGGGTGGTAGGGGATGTACGGG + Intergenic
1044775049 8:95678610-95678632 GCGGGGGAAGGGGGACTTCCTGG + Intergenic
1045929494 8:107605448-107605470 GGGGGTGGTGGAGGTCCTCTAGG + Intergenic
1048981826 8:139706508-139706530 GCGGGTGGAATGGGAGCTCCTGG + Intergenic
1048993250 8:139773663-139773685 GCGGGTGGTGAGGGACTTTGAGG - Intronic
1049519535 8:143080874-143080896 GCTGGAGGTGGGGGACGTCCTGG + Intronic
1049531543 8:143157994-143158016 GAGGGTGGGGGGGGACCCCCAGG - Exonic
1049567485 8:143348608-143348630 GGGGGGGGTGGGGGCCCTCCAGG + Intronic
1049660486 8:143817635-143817657 GCGGCAGGTGGGAGGCCTCCAGG + Exonic
1049772322 8:144389215-144389237 GCAGGAAGTGGGGGACATCCTGG - Intronic
1049796901 8:144501065-144501087 GGGGGTGGGCGGGGTCCTCCGGG + Intronic
1051418868 9:16870987-16871009 GCGGGAGGCGGGGGACCGGCGGG + Intergenic
1053426862 9:38015920-38015942 GAGGCTGGTTGGGGACCACCCGG + Intronic
1053799626 9:41756167-41756189 GTGGGTGAGGGGGGACTTCCAGG - Intergenic
1054145592 9:61558831-61558853 GTGGGTGAGGGGGGACTTCCAGG + Intergenic
1054188035 9:61968222-61968244 GTGGGTGAGGGGGGACTTCCAGG - Intergenic
1054465332 9:65489939-65489961 GTGGGTGAGGGGGGACTTCCAGG + Intergenic
1054650481 9:67620354-67620376 GTGGGTGAGGGGGGACTTCCAGG + Intergenic
1054876955 9:70107147-70107169 GTGGGTCTTTGGGGACCTCCTGG - Intronic
1057229192 9:93308596-93308618 GCGGGTGGGGCGGGTGCTCCTGG + Intronic
1057235719 9:93357633-93357655 CTGGGTGATGGGGGACCTCGTGG + Intergenic
1058609340 9:106757786-106757808 GGGGGTGGTGGGTTCCCTCCAGG + Intergenic
1060147880 9:121268050-121268072 GCGGGTGGGGGAGGAGCGCCAGG - Intronic
1061084565 9:128391580-128391602 GCAGATGGGGAGGGACCTCCAGG - Exonic
1061542109 9:131283054-131283076 GCGGGGGGCGGGGGACCGCGGGG - Intergenic
1061618696 9:131796756-131796778 GCTGTCGGTGGGGGGCCTCCTGG - Intergenic
1061851656 9:133419521-133419543 GCAGGTGCTGGGGGCTCTCCAGG + Intronic
1062117962 9:134819173-134819195 GCTGGTGGTGGGGAACCTGAGGG + Intronic
1062500028 9:136848342-136848364 GCGGGTGTGCGGGGACCTCTCGG - Exonic
1062525790 9:136977620-136977642 GGGGGTGCTGGGCGACCTGCAGG + Exonic
1062567926 9:137171489-137171511 GCGTGTGCTGGGGGAGCTCCGGG - Intronic
1062595263 9:137296340-137296362 GTGGGTGGAGGGCGGCCTCCCGG + Intergenic
1062627621 9:137450402-137450424 GCGTGTGGTGGGGGAGATCAAGG - Intronic
1062627672 9:137450579-137450601 GCGTGTGGTGGGGGAGATCAAGG - Intronic
1062627728 9:137450776-137450798 GCGTGTGGTGGGGGAGATCAAGG - Intronic
1062702740 9:137916543-137916565 GAGGGTGGCTGGAGACCTCCTGG - Intronic
1062703522 9:137920921-137920943 GAGGGTGGTGGCGGAACTCCAGG + Intronic
1185945212 X:4367883-4367905 GCTGGTGATGGGCGAACTCCAGG + Intergenic
1195164695 X:102207662-102207684 GTGGGTGCTGGGGGAGGTCCTGG + Intergenic
1195194163 X:102479429-102479451 GTGGGTGCTGGGGGAGGTCCTGG - Intergenic
1195654828 X:107324214-107324236 GCGGGGGGCGGGGCGCCTCCGGG - Intergenic
1197226741 X:123961785-123961807 GCGCGTGGTGGGGGAACTGCTGG + Intronic
1198293148 X:135257956-135257978 TTGGGTGGTGGGGGGGCTCCGGG - Intronic
1199614687 X:149647437-149647459 CAGGGTGGTGGGGGCCTTCCTGG - Intergenic
1199852745 X:151737129-151737151 GCGGGGGTTGAGGGAGCTCCAGG + Intergenic