ID: 1084279233

View in Genome Browser
Species Human (GRCh38)
Location 11:68076262-68076284
Sequence CAAGCTAATGAATTTTAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084279230_1084279233 28 Left 1084279230 11:68076211-68076233 CCTAATTTGTGGTTTTGTGTATA 0: 1
1: 0
2: 4
3: 26
4: 457
Right 1084279233 11:68076262-68076284 CAAGCTAATGAATTTTAGGGTGG 0: 1
1: 0
2: 1
3: 22
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084279233 Original CRISPR CAAGCTAATGAATTTTAGGG TGG Intronic
903955056 1:27019750-27019772 CAAGCTACTGCATTTTAGCCTGG - Intergenic
906676830 1:47699239-47699261 ACAGCTCATGTATTTTAGGGAGG + Intergenic
906784034 1:48598225-48598247 GTAGATAATGGATTTTAGGGGGG + Intronic
908502825 1:64761329-64761351 CCAGACAATGAATTTTGGGGGGG - Intronic
911286395 1:95998826-95998848 GAAGCTAAAAAATTTTAGGCAGG + Intergenic
911684216 1:100756333-100756355 TAAGCCACTGAATTTTGGGGTGG - Intergenic
913310110 1:117481492-117481514 TAAGCTACTAAATTTTAGAGGGG - Intronic
913367133 1:118051234-118051256 CAAGATAATAAATGTTGGGGAGG + Intronic
918080892 1:181206978-181207000 CAAGCTAATGACTTCCAGCGAGG - Intergenic
919010582 1:191956697-191956719 CAAGCTAATGAATTTTTGATTGG + Intergenic
920750273 1:208667892-208667914 GAAGCTACTGACTTTTGGGGTGG + Intergenic
921522412 1:216172968-216172990 ACAGCTATTGAATTTCAGGGTGG - Intronic
921607705 1:217174941-217174963 CAAGCTACTAAATTTTGAGGTGG - Intergenic
922708899 1:227811637-227811659 AAAGGTATTGAATTTTAGGCTGG - Intergenic
1062982717 10:1738452-1738474 TGTGCTAATGAATTTTAGAGTGG - Intergenic
1063049232 10:2428245-2428267 CAAGCTAATGTATTATTGGGAGG + Intergenic
1063423086 10:5929306-5929328 CAAGCTAATCAGTTTTATGCAGG - Intronic
1064168545 10:13007852-13007874 CCAGCTAAAGACTTTTAGAGTGG - Intronic
1064497959 10:15935301-15935323 GAAGCTGATGAATTTGAGTGAGG + Intergenic
1065549496 10:26856369-26856391 CAAGCTACTGAACTTTAGGTTGG + Intronic
1065783265 10:29190269-29190291 CAACATAATGAATTTTGTGGTGG + Intergenic
1066384146 10:34927944-34927966 CAAGCTGAAGAATGTTAGGCTGG + Intergenic
1067822288 10:49540660-49540682 CCAGCATATGAATTTTGGGGAGG - Intergenic
1068957689 10:62834233-62834255 CAAGGTAATGTGTTTTATGGAGG - Intronic
1069534754 10:69244860-69244882 CAATCAAAAGAAATTTAGGGTGG - Intronic
1072113906 10:92349963-92349985 CAAGCTATTGAATGATAGTGAGG - Intronic
1072390118 10:94975086-94975108 CTAGCTGCTGAATTTTAGGAAGG - Intronic
1073164524 10:101433326-101433348 CAAGCTGATAAATTCTAGGAAGG + Intronic
1076221911 10:128740498-128740520 CAAGCAAATGTATTTTTTGGGGG - Intergenic
1080144019 11:28957792-28957814 CTAGCAAATGAATTTCAGGATGG + Intergenic
1080989352 11:37511573-37511595 CAAGCAATTGTATTTTAAGGTGG - Intergenic
1083168699 11:60908849-60908871 CTAGCAAATAATTTTTAGGGAGG + Intergenic
1084279233 11:68076262-68076284 CAAGCTAATGAATTTTAGGGTGG + Intronic
1086892055 11:92269897-92269919 CAAGAAAATGAATTTTGGGGTGG - Intergenic
1087745463 11:101940494-101940516 TAAGCTACTAAATTTTAGGGTGG - Intronic
1088221553 11:107575572-107575594 TAAGCTTATGAATTTTGTGGGGG - Intergenic
1088300320 11:108351415-108351437 TAAGCTACTAAATTTTGGGGTGG - Intronic
1089941480 11:122422485-122422507 CAAGTCACTGAATTTTGGGGTGG + Intergenic
1090313777 11:125766896-125766918 CAAGCTTATGAAGCATAGGGAGG - Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1094233769 12:28139335-28139357 CATGCTATTGAATTTTGGGATGG - Intronic
1095759815 12:45818022-45818044 TAAGATAATGAATGTTTGGGGGG + Intronic
1095843351 12:46718935-46718957 CAAGCCAATAAGTTTTGGGGTGG + Intergenic
1097294427 12:57947298-57947320 CAAGCTAAACCATTTTAGGTGGG + Intronic
1097309710 12:58105263-58105285 GAAGCTAATCCATTTTAGAGTGG + Intergenic
1100445461 12:94656015-94656037 CAAGCCAAAGCATTTTAAGGTGG - Intergenic
1101151979 12:101891290-101891312 CAATCTAATAAATTTCAGGCTGG + Intronic
1101158294 12:101948413-101948435 TAAGCCACTGAATTTTGGGGTGG - Intronic
1101291919 12:103378768-103378790 CAAGCTATTGAAGCTTAGGGAGG - Intronic
1101769390 12:107734908-107734930 CTAGCTAATGAATGTTTTGGTGG + Intronic
1106224150 13:27772595-27772617 CAGGCAAATCCATTTTAGGGTGG - Intergenic
1106648028 13:31657599-31657621 CCAGCTAATGTCATTTAGGGTGG - Intergenic
1106796968 13:33216845-33216867 CAAGCTAAGGAATCTGAGAGTGG + Intronic
1107207092 13:37805180-37805202 TAAGGTAATGAATATTAGAGAGG + Intronic
1107440387 13:40422012-40422034 CATGTAAGTGAATTTTAGGGAGG - Intergenic
1111236324 13:85413212-85413234 CAAGTAAATGTATTTTAGGGGGG + Intergenic
1111861476 13:93712367-93712389 CAAGTTAATGAAATGCAGGGAGG + Intronic
1114197553 14:20492451-20492473 CATGCTAATGTATTTTAAGAAGG + Intergenic
1116694551 14:48156140-48156162 CAAGCTAATAAAAATTTGGGAGG + Intergenic
1120739349 14:88090590-88090612 CAGGCTAATAAATTATAGGATGG + Intergenic
1122683361 14:103484757-103484779 CCAGCTAATTAATTTTAGACAGG - Intronic
1124236806 15:27996263-27996285 CAGGCTAATGATTTTGAGGTAGG - Intronic
1125347672 15:38734454-38734476 TAAGCCAGTGAGTTTTAGGGTGG - Intergenic
1127590550 15:60418103-60418125 CAAAATGATGAATTTTAGGAAGG - Intergenic
1128894502 15:71359969-71359991 TAAGCTACTCAATTTTGGGGTGG - Intronic
1130265651 15:82400001-82400023 GAATCTAATGAATTTTTAGGAGG - Intergenic
1130506358 15:84546913-84546935 TAATCTAATGAATTTTTAGGAGG + Intergenic
1131796554 15:96023254-96023276 CAAGCCAATGAGTCTTGGGGTGG + Intergenic
1134387631 16:13788627-13788649 CAAGCTATTGAATTTTGGAGTGG - Intergenic
1135499782 16:22985133-22985155 CTACTAAATGAATTTTAGGGTGG + Intergenic
1137981143 16:53070988-53071010 ATTGCTTATGAATTTTAGGGTGG + Intronic
1139813467 16:69643987-69644009 CATGGTAAAGAATTTTAGGCTGG + Intronic
1140816545 16:78626476-78626498 GGAGTTAATGAATTTCAGGGAGG + Intronic
1141411315 16:83835247-83835269 CAAGCAAATGAATTACAGAGGGG - Intergenic
1142496800 17:310329-310351 CAAGCTAATGAGCTTGTGGGTGG - Intronic
1143155921 17:4835958-4835980 CAAGCCCTTGCATTTTAGGGTGG - Intronic
1144528431 17:16011924-16011946 AAAGTTAATGAGTTTTGGGGAGG - Intronic
1149515215 17:57275962-57275984 AAGGATAATGAATTTGAGGGAGG - Intronic
1151147221 17:72052654-72052676 CAAGTTAATGAATTCTTTGGGGG - Intergenic
1153930977 18:9879364-9879386 CCAGCATATGAATTTTGGGGGGG + Intergenic
1154986808 18:21559970-21559992 CAAGCATATGAATTTAACGGAGG + Intronic
1155835564 18:30579092-30579114 AAATTCAATGAATTTTAGGGGGG + Intergenic
1155859365 18:30877727-30877749 CAAGTAAATAAATTTTAAGGAGG + Intergenic
1159322857 18:66876263-66876285 CAAACTGATGAATTTTATGTTGG - Intergenic
1161879852 19:6941074-6941096 CAAGCTCAAGAATTTAAGGATGG - Intergenic
1166659321 19:44635842-44635864 CAAGCCAGTGAATTTTGGGGAGG - Intronic
1167957234 19:53075783-53075805 CAAACTAATCAATTTCAAGGAGG + Intronic
926968243 2:18439891-18439913 AAGGCTAATGAATTCTAGAGTGG - Intergenic
927061903 2:19431281-19431303 CCAGATAAAGAAATTTAGGGAGG - Intergenic
928341258 2:30445149-30445171 CAAGCTCCTGAATTTTTGTGGGG - Intergenic
928523316 2:32113379-32113401 AAAACTAATCAATTTTAGGCCGG - Intronic
929772571 2:44904608-44904630 CTAGGTAATTATTTTTAGGGCGG - Intergenic
931413671 2:62059928-62059950 CAGCTTAATGAATTTTGGGGGGG + Intronic
937541396 2:122958811-122958833 CAAGGTAATGAATTTATAGGTGG + Intergenic
939881381 2:147635403-147635425 CAAGCTAAGGAATCTGAGAGTGG + Intergenic
940772425 2:157853630-157853652 CTAGCTATTGGATTTTAGGGAGG - Intronic
943516528 2:188894093-188894115 TGAGCTAATGAACTCTAGGGAGG + Intergenic
946848019 2:223878370-223878392 CTAGCAAATGAGTTTTAGCGGGG - Exonic
947300773 2:228686314-228686336 CAAGGTATAGAATTTTAGGTTGG - Intergenic
947553409 2:231065201-231065223 CAAGCCAATGAATTATGGAGAGG + Intronic
1170151029 20:13226469-13226491 TAAGCCACTAAATTTTAGGGTGG - Intronic
1170300966 20:14884238-14884260 TAAGCCAATAACTTTTAGGGTGG - Intronic
1171053653 20:21884979-21885001 CAACATAATGAATTTGAGGGGGG + Intergenic
1172216708 20:33240715-33240737 CAAGCTAACCAATTTTATGCTGG + Intronic
1173129162 20:40371495-40371517 TCAGCACATGAATTTTAGGGGGG - Intergenic
1173823846 20:46035067-46035089 CAGGATAATGAATTGTAGGTGGG - Intronic
1174477188 20:50803983-50804005 GTAGAAAATGAATTTTAGGGAGG + Intronic
1174958574 20:55129696-55129718 CATGCTAAGGATTTTTTGGGAGG - Intergenic
1175684507 20:61017808-61017830 CATGCTGATGACTTTTTGGGGGG + Intergenic
1177972690 21:27809908-27809930 CAAACTACTGAATTTTATGGAGG - Intergenic
1178434922 21:32549664-32549686 CAAGCTACTCAATTTTGGAGAGG - Intergenic
1178946119 21:36949171-36949193 TAAGCCACTGAATTTTGGGGTGG - Intronic
1182398356 22:30054088-30054110 CAAGGTAATGACTTTTTGAGGGG - Intergenic
1182987923 22:34738586-34738608 CAAGCCATTAAGTTTTAGGGTGG + Intergenic
1183159471 22:36102260-36102282 CAAGCCACTGAGTTTTAGGGTGG + Intergenic
1183614176 22:38932722-38932744 GAAGCTGGTGACTTTTAGGGAGG + Intergenic
1184156175 22:42668917-42668939 TGAGCTACTGAATTTTGGGGTGG - Intergenic
1184904206 22:47469171-47469193 AAAGCTCATGAATCTTAGGGTGG + Intronic
949528335 3:4928479-4928501 TAAGCCACTAAATTTTAGGGTGG - Intergenic
951046457 3:18044517-18044539 CAAGTTCATGAATTTTAGGGTGG + Intronic
951365588 3:21778036-21778058 TAAGTTAATGAGTTCTAGGGTGG + Intronic
951615804 3:24542381-24542403 CAAGCTAATGATTTATGGAGGGG + Intergenic
951855812 3:27195968-27195990 CAAGCCCATGAAGTTAAGGGAGG + Intronic
954338086 3:49931856-49931878 CAAGTTAATGAAATATAGGCAGG - Intergenic
956805992 3:72811981-72812003 CAAGATAATGACTTTGAAGGGGG - Intronic
956884850 3:73548627-73548649 TAAGCTAATGAATTATGAGGGGG + Intronic
958724619 3:97889499-97889521 TTAGCTAATGGATTTTGGGGAGG + Intronic
959169537 3:102828523-102828545 CAAGTTAATGAATTTTGGGAAGG - Intergenic
959266870 3:104152108-104152130 CACGGTTATGAATTTTAAGGGGG + Intergenic
960624160 3:119664218-119664240 CAACCTCATGAATTTTAGTTAGG - Intronic
961139017 3:124539907-124539929 CAAGCTAATTTTTTTTGGGGGGG + Intronic
969335595 4:6507707-6507729 TAAGCCACTGAATTTTGGGGTGG + Intronic
970197618 4:13567474-13567496 GAAGCTACTGGATTTTAGGCTGG + Intergenic
971271877 4:25157468-25157490 TAAGCCACTTAATTTTAGGGTGG + Intronic
972206996 4:36785740-36785762 CAAGCCAATGAGTTTTAAGGAGG + Intergenic
973706907 4:53590079-53590101 CAAGCTTGTGAGTTTAAGGGGGG - Intronic
975570461 4:75812036-75812058 CAACCTAAGGAATTTAGGGGTGG - Intronic
976663863 4:87569244-87569266 TAACTTTATGAATTTTAGGGGGG + Intergenic
978563984 4:110062595-110062617 CAAGCTAATGTAACTTGGGGAGG - Intronic
978868553 4:113545891-113545913 TAAGCAGATGATTTTTAGGGAGG - Intronic
979529295 4:121751728-121751750 CATGCTAATGAGGTTTAGGCTGG - Intergenic
980678114 4:136117123-136117145 TAAGCTACTGAAATTTAGGATGG - Intergenic
980705734 4:136490902-136490924 CAATCTAATGACTTTTATGTAGG - Intergenic
988904025 5:35766305-35766327 AAAGATAATGAATTCTTGGGTGG - Intronic
988939287 5:36126570-36126592 CTAGATAGAGAATTTTAGGGAGG - Intronic
989667505 5:43873678-43873700 CATGCTACTAAATTTTAGGGTGG - Intergenic
990205384 5:53423339-53423361 CAAGGTACTGACTTTTAGGGAGG + Intergenic
990566466 5:57034599-57034621 TAAGCCATTGAGTTTTAGGGTGG - Intergenic
991111710 5:62907562-62907584 CTAGGTTATGAATTTTTGGGAGG + Intergenic
991299791 5:65119312-65119334 TCAACTAATGAATTTCAGGGGGG - Intergenic
991601790 5:68358355-68358377 AAAGCAAATGGATTTTGGGGTGG - Intergenic
993633609 5:90317722-90317744 CAAGCTATTGAACCTGAGGGAGG - Intergenic
993778986 5:92041805-92041827 TAAGCTAATCAATTTAAGAGTGG - Intergenic
1006696859 6:35938438-35938460 TAAGCTACTAAATTTTGGGGTGG + Intergenic
1006953149 6:37842173-37842195 CCAACAAATGAATTTTGGGGAGG + Intronic
1006966608 6:37992565-37992587 TAAGCTGAAGAATTTAAGGGTGG - Intronic
1007789616 6:44301572-44301594 AGAGCTAATGACTTTTGGGGTGG - Intronic
1008166014 6:48139356-48139378 CAAGCTTATATATTTTTGGGGGG - Intergenic
1011080818 6:83488915-83488937 AAAGGACATGAATTTTAGGGGGG - Intergenic
1013065176 6:106676985-106677007 TAAGCTGCTGAATTTTGGGGTGG + Intergenic
1013920367 6:115396082-115396104 GAAGCTACTGATTTTTAGGTGGG + Intergenic
1014036300 6:116770137-116770159 CAAGGTAATGAAATAGAGGGTGG - Intergenic
1014984921 6:127993596-127993618 CATGCTATTAAATTTTAGGTTGG - Intronic
1015154223 6:130073843-130073865 CAAACTAATTATTTTTAGGATGG + Intronic
1015272588 6:131352658-131352680 CAATCTAATCAATTTTGAGGTGG + Intergenic
1020943161 7:14565400-14565422 TAAGCCACTGAATTTTAGGAAGG + Intronic
1022753237 7:33254468-33254490 CAAGCTAATTAATATTAGTATGG + Intronic
1025862688 7:65346539-65346561 CAGCTTAATGAATTTTTGGGTGG + Intergenic
1030497600 7:110319144-110319166 CCAGGTAAGGAATGTTAGGGTGG + Intergenic
1030620735 7:111788348-111788370 CAAGATAATGATTTTAAGTGGGG - Intronic
1031511124 7:122651086-122651108 CATGGTAATGAAAATTAGGGAGG - Intronic
1032427588 7:131833924-131833946 CAAATTAATGAATTTTAGGCTGG + Intergenic
1033109679 7:138563111-138563133 CCAGCTAATGGACTTTATGGTGG - Intronic
1038903167 8:31866886-31866908 CTAGGTAATGCATTTTAGGAGGG + Intronic
1044372647 8:91430713-91430735 AAAACTAATGAATTTTTGGATGG + Intergenic
1044675587 8:94725320-94725342 CAAGATGATTAATTCTAGGGAGG + Intronic
1045629913 8:104106223-104106245 CATGAGAATGAATTTTAGGCTGG - Intronic
1047871204 8:129084117-129084139 CAAGTCAATGTATTTTAGGGTGG - Intergenic
1048048423 8:130794706-130794728 ACAGCACATGAATTTTAGGGAGG + Intronic
1048061543 8:130924301-130924323 CAAGCTAAGGAATCTGAGAGTGG + Intronic
1049045598 8:140148968-140148990 GAAGCTAATGCATTTGGGGGTGG + Intronic
1050044911 9:1533002-1533024 AAATGTAATGAATGTTAGGGAGG + Intergenic
1050161346 9:2722676-2722698 TAAGCCATTGAATTTCAGGGTGG - Intronic
1050930510 9:11317877-11317899 TAAGGTTATGAATTTTAGGGAGG - Intergenic
1052605703 9:30697195-30697217 CAAGCTTATCAATTTTTGTGGGG + Intergenic
1053223572 9:36332044-36332066 CAAGCTACTAAATTTTAGTTAGG - Intergenic
1055221891 9:73945248-73945270 GAAGCTGATGAATTATACGGAGG - Intergenic
1056388063 9:86115954-86115976 CCAGCTAATGTTTTGTAGGGGGG - Intergenic
1056513917 9:87332327-87332349 TAAGCTGTTAAATTTTAGGGTGG + Intergenic
1056957847 9:91096731-91096753 CCACCATATGAATTTTAGGGGGG + Intergenic
1057239626 9:93397302-93397324 CAAGCTACAGAATTCTAGGTTGG + Intergenic
1057842222 9:98495390-98495412 CATGCTAATGACTTTAAGTGAGG + Intronic
1187023124 X:15405543-15405565 AAAGCACATGAATTTTAAGGTGG - Intronic
1188602074 X:31979350-31979372 CAAAATAATGAAATTTAGGCTGG - Intronic
1192050185 X:67717645-67717667 CAAGCTGCTGTATTTTAGTGAGG - Intronic
1194405013 X:93485981-93486003 CAGGCTAATGCATTTTAAGGGGG + Intergenic
1194906909 X:99588938-99588960 AAAGCTAATGAATTTAAATGAGG - Intergenic
1196237175 X:113296249-113296271 CAAGAGAAGGAATTTGAGGGAGG - Intergenic
1197155077 X:123261828-123261850 ACAGCTAATGCATTGTAGGGGGG - Intronic
1198755050 X:139973888-139973910 TAAGCCACTAAATTTTAGGGTGG + Intergenic
1201385590 Y:13436597-13436619 CATGCTAAAGAATTTCAAGGAGG + Intronic