ID: 1084279685

View in Genome Browser
Species Human (GRCh38)
Location 11:68079846-68079868
Sequence CACCTGATCTATAGGCCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084279685_1084279694 16 Left 1084279685 11:68079846-68079868 CCCTTTGGCCTATAGATCAGGTG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1084279694 11:68079885-68079907 CAACATGAGAAGAGGGCCTATGG 0: 1
1: 0
2: 0
3: 16
4: 149
1084279685_1084279696 28 Left 1084279685 11:68079846-68079868 CCCTTTGGCCTATAGATCAGGTG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1084279696 11:68079897-68079919 AGGGCCTATGGTCAAATCATGGG 0: 1
1: 0
2: 0
3: 4
4: 80
1084279685_1084279695 27 Left 1084279685 11:68079846-68079868 CCCTTTGGCCTATAGATCAGGTG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1084279695 11:68079896-68079918 GAGGGCCTATGGTCAAATCATGG 0: 1
1: 0
2: 0
3: 6
4: 85
1084279685_1084279692 8 Left 1084279685 11:68079846-68079868 CCCTTTGGCCTATAGATCAGGTG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1084279692 11:68079877-68079899 AGACAGGACAACATGAGAAGAGG 0: 1
1: 0
2: 1
3: 38
4: 423
1084279685_1084279697 29 Left 1084279685 11:68079846-68079868 CCCTTTGGCCTATAGATCAGGTG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1084279697 11:68079898-68079920 GGGCCTATGGTCAAATCATGGGG 0: 1
1: 0
2: 0
3: 5
4: 71
1084279685_1084279690 -8 Left 1084279685 11:68079846-68079868 CCCTTTGGCCTATAGATCAGGTG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1084279690 11:68079861-68079883 ATCAGGTGACCGAGGGAGACAGG 0: 1
1: 0
2: 0
3: 9
4: 140
1084279685_1084279693 9 Left 1084279685 11:68079846-68079868 CCCTTTGGCCTATAGATCAGGTG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1084279693 11:68079878-68079900 GACAGGACAACATGAGAAGAGGG 0: 1
1: 0
2: 1
3: 25
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084279685 Original CRISPR CACCTGATCTATAGGCCAAA GGG (reversed) Intronic
904190554 1:28739888-28739910 CCCCAGATTAATAGGCCAAAAGG + Intronic
906630156 1:47360365-47360387 CATCTGATTTATATGCCAAATGG - Intronic
908080163 1:60568665-60568687 CACCTGATATAAAGTCCAACAGG + Intergenic
909420991 1:75465014-75465036 CATCTGCACTATAGACCAAATGG + Intronic
909947598 1:81681058-81681080 GCTCTGTTCTATAGGCCAAAGGG - Intronic
911283732 1:95963270-95963292 AATCTGATATATAGACCAAACGG - Intergenic
911666031 1:100553460-100553482 AATCTGCTCTATAGACCAAATGG - Intergenic
1067335346 10:45358201-45358223 AATCTGAACTATAGACCAAATGG + Intergenic
1069050824 10:63791264-63791286 CATCTGCACTATAGACCAAATGG + Intergenic
1070967315 10:80537475-80537497 CTCATTATATATAGGCCAAAGGG + Intergenic
1072060012 10:91800331-91800353 CAACTGATACATAAGCCAAAGGG + Intronic
1072378613 10:94842005-94842027 CATCTGCACTATAGACCAAATGG - Intronic
1075830275 10:125404304-125404326 AACCTGTGCTATAGACCAAATGG - Intergenic
1075860991 10:125676128-125676150 AAACTGAACTTTAGGCCAAATGG - Intronic
1082195259 11:49297248-49297270 AATCTGCACTATAGGCCAAATGG - Intergenic
1084279685 11:68079846-68079868 CACCTGATCTATAGGCCAAAGGG - Intronic
1085178809 11:74514702-74514724 AACCTGCACTATAGACCAAATGG + Intronic
1093815356 12:23539153-23539175 TAAATGATCTATACGCCAAAAGG + Intronic
1094440773 12:30473730-30473752 AATCTGCTCTATAGACCAAATGG + Intergenic
1095280678 12:40349173-40349195 CATCAGATCTATGGGACAAAAGG - Intronic
1095479677 12:42622138-42622160 GACCTGATCCATGGGCAAAAGGG - Intergenic
1098207595 12:68129363-68129385 AACCTGCACTATAGACCAAATGG - Intergenic
1099808497 12:87549964-87549986 AATCTGCACTATAGGCCAAATGG + Intergenic
1100593281 12:96049585-96049607 TTCCTGAACTCTAGGCCAAAAGG + Intergenic
1108700835 13:52942780-52942802 CACCAGCTCTGTAGGCCAAGTGG + Intergenic
1110917239 13:81036724-81036746 AACCTGCACTATAGGCCAAATGG + Intergenic
1112626723 13:101113320-101113342 CAGGTGAGCTCTAGGCCAAAGGG - Intronic
1114880938 14:26785124-26785146 CACCTAATCAATATGGCAAAGGG + Intergenic
1118692014 14:68349213-68349235 CATTTGACATATAGGCCAAATGG + Intronic
1126440866 15:48686826-48686848 AATCTGAACTATAGACCAAATGG + Intergenic
1126745353 15:51820415-51820437 AATCTGCTCTATAGGCCAAATGG + Intergenic
1129588556 15:76893548-76893570 GAACAGTTCTATAGGCCAAATGG + Intronic
1137581996 16:49639230-49639252 CACCAGTCCCATAGGCCAAAAGG + Intronic
1140157819 16:72452098-72452120 AATCTGCTCTATAGACCAAATGG - Intergenic
1141038240 16:80647667-80647689 CATCTGCACTATAGGCCAAATGG + Intronic
1145824793 17:27868703-27868725 CATGTGGTCTACAGGCCAAATGG + Intronic
1150582654 17:66489449-66489471 CACTTAATCTATATGCAAAATGG - Intronic
1150835412 17:68559106-68559128 CTTCTGACCTATAGGACAAATGG + Intronic
1155443676 18:25887777-25887799 AATCTGCACTATAGGCCAAATGG + Intergenic
1157495959 18:48157770-48157792 CACCTGATATATATGCCAGCGGG - Intronic
1159896215 18:73998746-73998768 AATCTGAACTATAGACCAAATGG - Intergenic
1163012836 19:14435900-14435922 CACCTGATCTACAGGACTACAGG + Intronic
925984119 2:9201365-9201387 AACCTTATCTAGGGGCCAAACGG + Intergenic
930527460 2:52547841-52547863 CCCCTGCACTATAGACCAAATGG - Intergenic
931406545 2:61984670-61984692 CATCTGCACTATAGACCAAATGG - Intronic
931457166 2:62419734-62419756 AATCTGCACTATAGGCCAAATGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
931989899 2:67779525-67779547 AATCTGCACTATAGGCCAAATGG + Intergenic
934644726 2:96051934-96051956 CAACTCATCTATAGGGAAAAAGG + Intergenic
934838139 2:97608023-97608045 CAACTCATCTATAGGGAAAAAGG + Intergenic
935478357 2:103554132-103554154 CATCTGCACTATAGGCCAAATGG - Intergenic
935688059 2:105702986-105703008 AATCTGTCCTATAGGCCAAATGG + Intergenic
943331444 2:186564340-186564362 AATCTGCTCTATAGACCAAATGG + Intergenic
943545267 2:189268662-189268684 CACTTCATCTTTTGGCCAAAAGG + Intergenic
947293971 2:228610186-228610208 CACATGATCTAAAGGCCAGATGG + Intergenic
1169587295 20:7099569-7099591 AATCTGCACTATAGGCCAAATGG + Intergenic
1169983703 20:11418026-11418048 CACCTTATCTATAGAGAAAAAGG - Intergenic
1170708927 20:18772026-18772048 AATCTGAACTATAGACCAAATGG - Intergenic
1174939112 20:54904561-54904583 AACCTGCACTATAGACCAAATGG + Intergenic
1177623198 21:23624103-23624125 CACCTGCACTATAGGTCAAAGGG + Intergenic
1178979638 21:37252071-37252093 TACCGGATCTTTAGACCAAATGG - Intronic
952279383 3:31908509-31908531 CAGCTGATCTAGAGGCAAGATGG + Intronic
952517040 3:34115585-34115607 AATCTGCACTATAGGCCAAATGG - Intergenic
952811387 3:37407078-37407100 CATCTGCACTATAGACCAAATGG - Intronic
959293507 3:104504633-104504655 AATCTAAACTATAGGCCAAATGG + Intergenic
959393087 3:105800938-105800960 CACATGACATATAAGCCAAATGG - Intronic
963318182 3:143783509-143783531 CACTTGATCAATAGGACAATAGG + Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
965735332 3:171813601-171813623 CACCTGGCCTATAGGGTAAATGG - Intergenic
972884912 4:43473471-43473493 AATCTGCACTATAGGCCAAATGG - Intergenic
975361672 4:73477605-73477627 CAGCTGATGTGTAGGCCAAAGGG - Intergenic
977185816 4:93934334-93934356 CATCTGAACTATAGACCAAATGG + Intergenic
977402515 4:96550678-96550700 CACCTCATTTCTAGGCTAAAAGG - Intergenic
977985921 4:103383021-103383043 AATCTGAACTATAGACCAAATGG + Intergenic
981075238 4:140584688-140584710 CACATGATCTAAAGGAGAAAGGG - Intergenic
986096870 5:4565639-4565661 AATCTGCTCTATAGACCAAATGG + Intergenic
988966283 5:36421402-36421424 CACCTGGACTATTGGACAAATGG + Intergenic
989259695 5:39405206-39405228 CACGTGATCAAAAGACCAAAAGG - Intronic
992492549 5:77259294-77259316 AACCTGTTCTATGGGCCAAGTGG - Intronic
993022080 5:82604093-82604115 AACCTGATATATAGGGTAAAAGG - Intergenic
996906196 5:128603570-128603592 AACCTGCACTATAGACCAAATGG - Intronic
999454429 5:151703064-151703086 CAACTGCTCTCTAGGCCAGAGGG + Intergenic
1002213524 5:177612093-177612115 CACCTGCTGTACAGGGCAAAGGG - Intergenic
1003219901 6:4151047-4151069 CATCTGCACTATAGACCAAATGG - Intergenic
1008847908 6:55990766-55990788 AACCTGCACTATAGCCCAAATGG - Intergenic
1012351178 6:98252549-98252571 CACCTAATCATTAAGCCAAAGGG - Intergenic
1013964776 6:115941521-115941543 ACTCTGATCTGTAGGCCAAAGGG + Exonic
1020515283 7:9110011-9110033 AACCTGCACTATAGACCAAATGG + Intergenic
1032714122 7:134489762-134489784 CACCTGGTTTATAGACAAAAAGG + Intergenic
1033472474 7:141662479-141662501 CACCTTATCTCTAGGGAAAAGGG + Exonic
1037910489 8:22741074-22741096 CATCTGGTCTATAGGCAACACGG - Intronic
1040139940 8:43898063-43898085 CACCTTATCTCCAGGCAAAATGG - Intergenic
1041027555 8:53702822-53702844 CATCTGCACTATAGACCAAATGG + Intergenic
1044356437 8:91228061-91228083 CTCCTGATCTGAAGTCCAAAAGG + Intronic
1044635147 8:94316270-94316292 AACCTGCACTATAGGCTAAATGG - Intergenic
1047139127 8:122116504-122116526 AAACTGAGCTATAGACCAAATGG + Intergenic
1048316517 8:133367074-133367096 CACCTGCTCTATAGAAGAAAAGG + Intergenic
1050030315 9:1378999-1379021 AGCCTGATATATAGGCCAAGTGG + Intergenic
1051840153 9:21387255-21387277 CATCTGCACCATAGGCCAAATGG - Intergenic
1052258493 9:26487668-26487690 AATCTGAACTATAGACCAAATGG - Intergenic
1052663757 9:31469064-31469086 CACATGATCTCTAGGCAAGATGG + Intergenic
1059831188 9:118097964-118097986 CACCTGATGTATAGGCATCATGG + Intergenic
1059927623 9:119227124-119227146 CACCTGATCTAAAAACCAAGAGG - Intronic
1189889966 X:45591054-45591076 AACCTGCCCTATAGACCAAATGG - Intergenic
1191686258 X:63894495-63894517 AAACTGGACTATAGGCCAAATGG + Intergenic
1192908244 X:75575650-75575672 CATCTGCACTATAGACCAAATGG - Intergenic
1193504536 X:82325946-82325968 AACCTGAACTATAGAACAAATGG - Intergenic
1193637319 X:83968459-83968481 AACTTGAACTTTAGGCCAAATGG + Intergenic
1195834619 X:109099972-109099994 AATCTGAACTATAGACCAAATGG - Intergenic
1197391690 X:125875012-125875034 AACCTGAAGTATAGACCAAATGG - Intergenic
1198664658 X:139007475-139007497 AATCTGAACTATAGACCAAATGG + Intronic
1200278566 X:154757453-154757475 CACCTGCTGTGCAGGCCAAACGG - Intergenic
1200737778 Y:6818656-6818678 AACCAGATATATAGACCAAATGG + Intergenic
1201676586 Y:16592567-16592589 CACTTGATATATAGCCCAAAAGG - Intergenic