ID: 1084280385

View in Genome Browser
Species Human (GRCh38)
Location 11:68086533-68086555
Sequence TCTCTAATACTGAGGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084280382_1084280385 -3 Left 1084280382 11:68086513-68086535 CCAGTACTTAATGAAAGACTTCT 0: 1
1: 0
2: 0
3: 22
4: 172
Right 1084280385 11:68086533-68086555 TCTCTAATACTGAGGGAAGTAGG 0: 1
1: 0
2: 1
3: 18
4: 136
1084280380_1084280385 23 Left 1084280380 11:68086487-68086509 CCATCAGACAGAATAAACTTATT 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1084280385 11:68086533-68086555 TCTCTAATACTGAGGGAAGTAGG 0: 1
1: 0
2: 1
3: 18
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084280385 Original CRISPR TCTCTAATACTGAGGGAAGT AGG Intronic
903496242 1:23769555-23769577 TCTCTAAAAATGAGGAAAATAGG + Intergenic
905418695 1:37823535-37823557 TCTTCAGGACTGAGGGAAGTAGG + Intronic
910370438 1:86509845-86509867 TCTCTAATAATTAGTGATGTTGG - Intergenic
917387865 1:174496893-174496915 TCTCTAATAGTGATGGGTGTGGG - Intronic
918564789 1:185916375-185916397 TCTCTAAGTCTGAGGAAAGTGGG + Intronic
919085651 1:192917624-192917646 TCTCAGAGACTGAGGGAGGTAGG - Intergenic
921382706 1:214541455-214541477 TCTCTCATACTCAGGGATGTGGG - Intronic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
1064375988 10:14796407-14796429 TATCTAATACTTAAGAAAGTGGG - Intergenic
1066337030 10:34488528-34488550 TCTCTTTTACTGGGGGAAGTGGG + Intronic
1067993785 10:51245865-51245887 TCTCTAGTACAGAAGGAGGTTGG - Intronic
1068493109 10:57748984-57749006 TCTCTAATGATGAGTGATGTTGG + Intergenic
1068688506 10:59892918-59892940 GCACCAATACTGAGGGAAGGGGG + Intronic
1069021635 10:63494946-63494968 TCTCACATACAGAGGGAAGTGGG - Intergenic
1069062868 10:63912532-63912554 TCTCTAAGTCTGGGGGAGGTTGG + Intergenic
1069490798 10:68858806-68858828 TCTCTCCTACTGATGGAAGAGGG - Intronic
1072360006 10:94650291-94650313 TCTCTAATAATCAGGAATGTTGG + Intergenic
1073061086 10:100734387-100734409 TTCCTATTCCTGAGGGAAGTTGG + Intergenic
1074176097 10:111004863-111004885 TCTCTAATTGTGTGGGGAGTGGG + Intronic
1074415135 10:113261038-113261060 TCTCCAATTCTGAGGGCAGCTGG + Intergenic
1074550877 10:114441045-114441067 GCTGTTATACTGAGCGAAGTCGG + Exonic
1081262978 11:40983746-40983768 TCTCTAATGATCAGGGATGTTGG - Intronic
1082646348 11:55731477-55731499 TCTCTAAAGCTGAGGGATGCTGG - Intergenic
1083129800 11:60614499-60614521 TTGCTAATACTGAGGTAAGTGGG - Intergenic
1083929327 11:65831651-65831673 TCTCTGGTTCAGAGGGAAGTGGG - Intronic
1084280385 11:68086533-68086555 TCTCTAATACTGAGGGAAGTAGG + Intronic
1085276160 11:75301659-75301681 GCTCTCACACTGAGGAAAGTGGG - Intronic
1086110254 11:83191609-83191631 TCTCTAAAAGTGAGGGGATTAGG + Intergenic
1086183071 11:83979201-83979223 TCTCTAAAGCTGAGGGAAGTAGG + Intronic
1086333052 11:85773048-85773070 TCTTTTATACAGTGGGAAGTAGG - Intronic
1086881130 11:92154768-92154790 TCTGTAATACTTGGGGAATTAGG - Intergenic
1091306488 11:134539470-134539492 TTTATAACACTCAGGGAAGTGGG + Intergenic
1093890611 12:24515762-24515784 TCTCTAATTCTGAGAAAAATCGG - Intergenic
1094442716 12:30497156-30497178 TCTCTGTTACTGAGGGATGCTGG - Intergenic
1094648189 12:32347970-32347992 TCTCTCTTACTGTGGGAAGAAGG - Intronic
1099530133 12:83768785-83768807 TCTCCAATAGTGATGGCAGTTGG + Intergenic
1100944599 12:99766829-99766851 TCTCTAAATCTGATGGAAATTGG + Intronic
1104078779 12:125412312-125412334 TCTCTAAGACTGAAGGGAGAGGG + Intronic
1104320919 12:127749922-127749944 TCTCTATAACTTTGGGAAGTAGG + Intergenic
1108225877 13:48288192-48288214 TTTCTTATACTGAGGGCATTTGG - Intergenic
1108489231 13:50963734-50963756 ATGCTAATACTGAGGGAAGCTGG - Intronic
1109359851 13:61281695-61281717 TCTGTAACACTGAGGGCAATGGG + Intergenic
1109554681 13:63956289-63956311 TCACTTTTTCTGAGGGAAGTAGG + Intergenic
1109907600 13:68865449-68865471 TCTCAAATACTGAGGTCAGTTGG - Intergenic
1110850891 13:80243701-80243723 CCTTTATTACTGAGTGAAGTTGG - Intergenic
1112230024 13:97580551-97580573 TCTATCATACTGGGGGTAGTAGG + Intergenic
1113359567 13:109617277-109617299 TCTCTATTGATAAGGGAAGTTGG - Intergenic
1114454180 14:22844832-22844854 TCTCCAGAACTGAGGGAATTTGG - Intronic
1131755020 15:95550362-95550384 TCTCAAACACTCAGGGAAGACGG - Intergenic
1131998562 15:98157192-98157214 TCTATAATATTGAGGTAAGTAGG + Intergenic
1132307967 15:100831331-100831353 TCTCCAATCCTGAGGGCAGTTGG - Intergenic
1134426206 16:14148641-14148663 TCAATAATAGTGAGGGCAGTCGG - Intronic
1135474124 16:22758524-22758546 TCTCTAATGATCAGGGATGTTGG + Intergenic
1146008502 17:29177247-29177269 TCTCTAATATTCAGAGAGGTTGG - Intronic
1149899001 17:60456570-60456592 CCTCTCATTCTGAGGGAAATGGG - Intronic
1156341910 18:36217428-36217450 TCTTTACTACTGAGGGTAGCTGG + Intronic
1158738050 18:60106375-60106397 TCTCTAATAATTAGTGATGTTGG - Intergenic
1158903281 18:61986365-61986387 TCTCTAATGTAGTGGGAAGTGGG - Intergenic
1159097130 18:63916468-63916490 TTGGTAATTCTGAGGGAAGTGGG + Intronic
1162328812 19:10014294-10014316 TCTCTAAAACAGAGGGCAGAGGG - Intronic
1166909488 19:46141732-46141754 TCTCTATCAGTGAGGGAAGTTGG - Intergenic
1166909829 19:46145556-46145578 TCTCTACCAGTGAGGGAAGCTGG - Intronic
1166923791 19:46251493-46251515 TCTCTATCAGTGAGGGAAGTTGG + Intergenic
1168691492 19:58380368-58380390 GCTCTAATAGTGAGTGAAGGAGG + Intronic
925400832 2:3571368-3571390 TCTCTAATTCAGAGTGAAGTTGG - Intergenic
931214354 2:60227395-60227417 TCTCTTACTCTGAGAGAAGTAGG - Intergenic
933817566 2:86080433-86080455 TCTTAAAGCCTGAGGGAAGTAGG + Intronic
935496881 2:103793060-103793082 TCTCTAATAATCAGTGATGTTGG - Intergenic
937172905 2:119895099-119895121 TCTCTGAGAATGAGGGAAGGAGG + Intronic
937233018 2:120411452-120411474 TCTCTAATAATCAGTGATGTTGG + Intergenic
942120900 2:172775793-172775815 TCTTTAAGACTGAGGGTTGTTGG + Intronic
942852175 2:180500603-180500625 TCTTTAATAATGAGGGACATTGG - Intergenic
942993189 2:182227968-182227990 TCTCTAATACTAAGAGTAGAAGG - Intronic
944363197 2:198883579-198883601 TCTCTAATACTGGGGAAAATAGG - Intergenic
1170488650 20:16847206-16847228 TATCTAACACTGTGGGAATTTGG + Intergenic
1170905207 20:20509104-20509126 TATTTAATACTGAAGGAAGGAGG + Intronic
1177514027 21:22123906-22123928 TCTCAAACCCTGAGGGAAGGGGG - Intergenic
1178272329 21:31202739-31202761 TCTGGAATACTGAGCTAAGTAGG + Intronic
1179061180 21:37981220-37981242 TCTCTTGTGCTGTGGGAAGTAGG + Intronic
1179586976 21:42379649-42379671 GCTGTAATAATAAGGGAAGTAGG - Intronic
1183931103 22:41236723-41236745 TCTCTTCTGCTGAGGGAAGATGG - Intronic
950490121 3:13299542-13299564 TCCCTACTGCTGAGGGATGTTGG + Intergenic
950551590 3:13669413-13669435 TGTCTGATACTGAAGGAAGCTGG + Intergenic
950739521 3:15039076-15039098 TTTCAAATACAGAGGGAACTGGG + Intronic
952518298 3:34128246-34128268 TCTCTAATAATCAGTGATGTTGG - Intergenic
953503438 3:43460073-43460095 TCCATAATAATGAGGGAAATGGG + Intronic
953855378 3:46495740-46495762 TCTCAACTAGTGAGGGAAGAAGG - Intergenic
955041648 3:55323021-55323043 TCTCTAATAAAGATGGAGGTAGG + Intergenic
956854192 3:73259844-73259866 CATCTAATCCTGAGGGATGTGGG + Intergenic
962961588 3:140316012-140316034 GTTCTAATTCTGAGGGAACTGGG + Intronic
963482940 3:145899950-145899972 TCTCAAATTCTGAGGTTAGTTGG + Intergenic
967789853 3:193536200-193536222 TCTCTATTCCTGAGGGATGTTGG - Intronic
967840604 3:194002157-194002179 TCTCTAGAACAGAGGGTAGTAGG - Intergenic
967846171 3:194044917-194044939 TCTAGAAGACTGAGTGAAGTCGG - Intergenic
969207219 4:5655990-5656012 TCCCTATTCCTGAGGGAAGTGGG + Intronic
971643287 4:29163007-29163029 TGTCTTATACTGTGGAAAGTGGG + Intergenic
977182094 4:93888229-93888251 ACTCTAATACTGAGCAAGGTTGG - Intergenic
981439148 4:144762668-144762690 TCTCTAATGCTCAGTGATGTTGG - Intergenic
981778792 4:148401366-148401388 CCTCTAGCACTGAGGGAAGCTGG - Intronic
982852261 4:160333913-160333935 TCTCTAATTCTTACGGAATTGGG + Intergenic
984707370 4:182857495-182857517 ACTCTAAGGCTGAAGGAAGTGGG - Intergenic
985147637 4:186910032-186910054 TCTCTATAACTGAGGGATTTGGG + Intergenic
985372559 4:189301774-189301796 TCTCTCATTCTCAGTGAAGTGGG - Intergenic
989740954 5:44771281-44771303 TCTAAAATACTGAGGGAAGAAGG + Intergenic
990267888 5:54098134-54098156 TCTGTAAGACTGAGGAAAGTTGG + Intronic
990449211 5:55919236-55919258 TCTCAAATTCTGTGGGAGGTGGG + Intronic
992301634 5:75387873-75387895 TCTCTAACACTGTGGGCTGTAGG + Intronic
998910796 5:146958001-146958023 GGTCGAATAATGAGGGAAGTAGG + Intronic
999704028 5:154255213-154255235 TCTCTAATAATTAGGAAAATGGG + Intronic
1000253748 5:159518950-159518972 TCTCTAATGCTTTGGGAATTGGG + Intergenic
1002559767 5:180073111-180073133 TGTCTCCTACTGCGGGAAGTGGG + Intergenic
1002632029 5:180588613-180588635 TATGTAATACTGGGGGAGGTGGG + Intergenic
1004701650 6:18085261-18085283 TTTCTAATCCTGAAGGAAGCTGG + Intergenic
1007407415 6:41642971-41642993 TCTCTAACACTGCGGGGAGGAGG + Intronic
1007668521 6:43531959-43531981 TTTTTAATACTAAGGTAAGTGGG - Intronic
1010328948 6:74599181-74599203 TGGCTAATACTGAGGGTAGAGGG - Intergenic
1010651559 6:78461236-78461258 TAAATAATACAGAGGGAAGTGGG - Intergenic
1012828018 6:104170043-104170065 TTCCTAATACCAAGGGAAGTTGG + Intergenic
1012846441 6:104395481-104395503 TGTCCAAGACTGAGGGAAGATGG - Intergenic
1013402335 6:109810867-109810889 TTTCTGATACTGAGGGAACTGGG - Intronic
1013953878 6:115818181-115818203 TGTCTAATACTGAGTGAACCAGG - Intergenic
1018221424 6:161584053-161584075 TCTCTAATACTCTGGGAAACTGG - Intronic
1018669182 6:166165947-166165969 TCTCTGCTGTTGAGGGAAGTGGG + Intronic
1020967055 7:14884318-14884340 CCTGTAATACTGAGGGAAAATGG - Intronic
1022477012 7:30717617-30717639 ACTCTAACACTGAAGGAAATTGG + Intronic
1023978689 7:45052992-45053014 TCTCTTATATTCAGGGAAGTGGG + Intronic
1024358825 7:48446321-48446343 TATCTAATACTGAGTGATTTGGG + Intronic
1026413106 7:70147284-70147306 TATTTAATAATGACGGAAGTAGG + Intronic
1030430603 7:109442619-109442641 TCTCAAAATCTGAGGGAAGATGG - Intergenic
1030898315 7:115089192-115089214 TCTTTGATACTGTGGGAAATAGG + Intergenic
1032696761 7:134343894-134343916 TCTCTAATGCTGAATTAAGTAGG - Intergenic
1034319889 7:150170246-150170268 TCACTCATTCTGAGGGAAGCCGG - Intergenic
1034709813 7:153181305-153181327 TCTCTAAAAATGAGGGATTTGGG + Intergenic
1037249102 8:16872039-16872061 TCTCTAATGGTCAGGGATGTTGG + Intergenic
1038856956 8:31344358-31344380 TCTCCAAAACTGAGGGCAGCTGG + Intergenic
1038900973 8:31843477-31843499 TCTTTTACAATGAGGGAAGTTGG + Intronic
1038969090 8:32610699-32610721 TCTCTAATTCTGAATAAAGTAGG - Intronic
1039803968 8:40983146-40983168 TCTCAAAGCCTGAGGGAATTGGG - Intergenic
1040852278 8:51913348-51913370 GCTCTAGTAATGAGGGAACTGGG - Intergenic
1040995225 8:53394265-53394287 GCTCTCATACTGAGGAAAGGAGG + Intergenic
1041789702 8:61679612-61679634 TTTCTAAAAATGAGGGAACTTGG + Intronic
1043294170 8:78643923-78643945 TCTCTAATAATCAGTGATGTTGG - Intergenic
1044285536 8:90408440-90408462 TTTGTTTTACTGAGGGAAGTTGG + Intergenic
1045820462 8:106330723-106330745 TCACTAATATTGAGGGTATTGGG + Intronic
1050126822 9:2365433-2365455 ACTATATTAGTGAGGGAAGTTGG - Intergenic
1050596855 9:7212704-7212726 TCTCTACAACTCTGGGAAGTAGG + Intergenic
1051449143 9:17176515-17176537 TCTCTAATCATGAGGGATATTGG + Intronic
1052669377 9:31535931-31535953 TCTCAAATACTGAGAAAAGGAGG + Intergenic
1055719423 9:79155142-79155164 TCTCTACTCCTGAGGCCAGTTGG + Intergenic
1058388922 9:104472026-104472048 TATATAATTCTGAGGGAGGTTGG - Intergenic
1058472368 9:105293449-105293471 TCTCAAATATTGAGGCAGGTAGG - Intronic
1186679608 X:11857957-11857979 TCTCTAATGCTCAGTGATGTTGG - Intergenic
1187786551 X:22894457-22894479 TCTCTAATTCTGATGAAAGATGG + Intergenic
1189826375 X:44922349-44922371 TCTCTAATAGTGGATGAAGTTGG + Intronic
1195424791 X:104716675-104716697 TCTCTAATAATCAGTGATGTTGG - Intronic
1196480937 X:116146905-116146927 TCTCTAGTAGTGAGTGAATTTGG + Intergenic