ID: 1084284046

View in Genome Browser
Species Human (GRCh38)
Location 11:68120631-68120653
Sequence CTGGGTAATCCAAGGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 146}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084284046_1084284060 10 Left 1084284046 11:68120631-68120653 CCCGCTTCCCTTGGATTACCCAG 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1084284060 11:68120664-68120686 AGGAGGGCTTTCGCCGGCTGCGG 0: 1
1: 0
2: 1
3: 10
4: 95
1084284046_1084284056 -6 Left 1084284046 11:68120631-68120653 CCCGCTTCCCTTGGATTACCCAG 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1084284056 11:68120648-68120670 ACCCAGGGCTGGGAGAAGGAGGG 0: 1
1: 1
2: 7
3: 96
4: 880
1084284046_1084284059 4 Left 1084284046 11:68120631-68120653 CCCGCTTCCCTTGGATTACCCAG 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1084284059 11:68120658-68120680 GGGAGAAGGAGGGCTTTCGCCGG 0: 1
1: 0
2: 0
3: 14
4: 224
1084284046_1084284055 -7 Left 1084284046 11:68120631-68120653 CCCGCTTCCCTTGGATTACCCAG 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1084284055 11:68120647-68120669 TACCCAGGGCTGGGAGAAGGAGG 0: 1
1: 1
2: 11
3: 102
4: 754
1084284046_1084284054 -10 Left 1084284046 11:68120631-68120653 CCCGCTTCCCTTGGATTACCCAG 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1084284054 11:68120644-68120666 GATTACCCAGGGCTGGGAGAAGG 0: 1
1: 0
2: 3
3: 89
4: 563
1084284046_1084284063 24 Left 1084284046 11:68120631-68120653 CCCGCTTCCCTTGGATTACCCAG 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1084284063 11:68120678-68120700 CGGCTGCGGTCCCCGGTCCCCGG 0: 1
1: 0
2: 0
3: 30
4: 171
1084284046_1084284061 17 Left 1084284046 11:68120631-68120653 CCCGCTTCCCTTGGATTACCCAG 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1084284061 11:68120671-68120693 CTTTCGCCGGCTGCGGTCCCCGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084284046 Original CRISPR CTGGGTAATCCAAGGGAAGC GGG (reversed) Intronic
900673263 1:3868914-3868936 CTGGGAAATGCAAGGGAACATGG - Intronic
904301123 1:29555598-29555620 CTGGGTAATCCGAGGCTTGCTGG + Intergenic
904456427 1:30650937-30650959 CTGGGTAATCCTAGGCTTGCAGG - Intergenic
905415742 1:37802665-37802687 CTGGGGAAACCAAGGCAGGCAGG + Intergenic
906273004 1:44496249-44496271 ATGGGAAATCCCAGTGAAGCTGG + Intronic
906542983 1:46602471-46602493 TTGGGAAAACCAAGGGAAACAGG + Intronic
907222131 1:52914847-52914869 GTGGGTGATCCGAGGGATGCAGG - Intronic
912315707 1:108666066-108666088 CTGGGTAACACTGGGGAAGCAGG + Intergenic
912491438 1:110064847-110064869 CTCGGCAGTCCAAGGGCAGCTGG + Exonic
922703711 1:227777788-227777810 CTGGGACATCCAAGGGAGGCTGG - Intronic
923596001 1:235361291-235361313 CTGGGCAATGCCTGGGAAGCAGG - Intergenic
1064255858 10:13742298-13742320 CTGGGGAATCCCAGGGAAGCAGG + Intronic
1064945075 10:20778221-20778243 GTGGGTACTCCTTGGGAAGCAGG + Intergenic
1069848698 10:71391090-71391112 CTGGGGAATGCAAGAGAGGCAGG - Intergenic
1070041407 10:72784036-72784058 CTGCTTGATCCAAGTGAAGCCGG + Intronic
1071404575 10:85317811-85317833 CTGGGGAAGTCAAGGGAAGAGGG + Intergenic
1071953644 10:90733061-90733083 CAGGGCAATCCAAGGGAAAAAGG + Intergenic
1072850055 10:98880617-98880639 CTTGATAATCAAAAGGAAGCAGG - Intronic
1073388867 10:103154874-103154896 CTAGGGAATCCATGGGAAGTTGG - Intronic
1076550182 10:131273127-131273149 CAGGGTAATGGAAGGGATGCGGG - Intronic
1076654024 10:132009312-132009334 GTAGGTAATCCAAGGAAGGCTGG - Intergenic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1078748562 11:14138609-14138631 ATGGGTAATCCAAGGCAGGCGGG + Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082801730 11:57419847-57419869 CTGGGTTCTCCAGGGGAAGGAGG + Intronic
1083777539 11:64901688-64901710 CTGGGAAATTCAAGGGATGGAGG - Intronic
1084284046 11:68120631-68120653 CTGGGTAATCCAAGGGAAGCGGG - Intronic
1084682640 11:70675784-70675806 CTGGGTAATGCCAGGGAGGAAGG + Intronic
1086839570 11:91667860-91667882 CTGGAGAATCCAAGGGGACCAGG + Intergenic
1087073873 11:94110491-94110513 GTGAGTAATCCAAGAGAAGAGGG + Intronic
1089672444 11:120065826-120065848 CTGGGAAATGGAAGGGAACCTGG + Intergenic
1091394018 12:142698-142720 CTGGGGAAGGGAAGGGAAGCCGG - Intronic
1092080181 12:5709577-5709599 CCAGGTAAGCCACGGGAAGCAGG + Intronic
1092257723 12:6936465-6936487 CTGGGCAATGCCTGGGAAGCTGG - Exonic
1098179252 12:67828602-67828624 CTGGGTAGGCCTAGGGAAGCAGG - Intergenic
1100748466 12:97671392-97671414 CTGGGTTATCCAAGATAAACTGG - Intergenic
1102502137 12:113359884-113359906 CTGGGGGATCCTAGGGAACCCGG + Intronic
1103952266 12:124557776-124557798 CTGGGTAAACCAGGGGAGGAAGG - Intronic
1104378800 12:128288855-128288877 CTGGGGAAATCAAGGGAAGGAGG - Intronic
1106882310 13:34144891-34144913 CTGGGCAAACCAAGACAAGCAGG - Intergenic
1107671805 13:42753971-42753993 CTGGGTGGTCCAAGGGAACAAGG - Intergenic
1108590065 13:51905448-51905470 CAGAGCAACCCAAGGGAAGCCGG + Intergenic
1111824496 13:93250769-93250791 CTGGGAAGCCAAAGGGAAGCAGG - Intronic
1112412919 13:99179340-99179362 CTGGGCAAACGGAGGGAAGCAGG - Intergenic
1112733719 13:102394809-102394831 CTCGGTAATCCGGGTGAAGCTGG - Intronic
1113899591 13:113788821-113788843 CTGGGAAACCCCAGGGAAGCTGG + Intronic
1115759518 14:36564911-36564933 TTGTTTAATCCAAAGGAAGCAGG + Intergenic
1115967901 14:38912472-38912494 CTGGAAAATCCAAGGCAAGTAGG + Intergenic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1119144929 14:72303533-72303555 TGGGGGAATCTAAGGGAAGCTGG - Intronic
1120238126 14:81916735-81916757 TTGGGTAGTTCAAGGGAAGGAGG - Intergenic
1121129157 14:91429415-91429437 CTGGGTAATGGAAGAGAAACAGG + Intergenic
1122663942 14:103316139-103316161 CTGGGAAATCCCAGGTAAACTGG - Intergenic
1125011008 15:34875126-34875148 CAGGGTAATCCAAAGAAGGCTGG + Intronic
1126347889 15:47716230-47716252 CTGTGTAACCCAAGGAAAGAAGG - Intronic
1128079003 15:64845235-64845257 ATGAGTGATCCAAGGGAGGCAGG + Intronic
1129016021 15:72469648-72469670 CTGGGAAGTCCCAGGCAAGCTGG - Intergenic
1141974224 16:87504216-87504238 CTGGGTAAGACAAAAGAAGCAGG - Intergenic
1150709073 17:67514526-67514548 CTGTGAAAGTCAAGGGAAGCCGG + Intronic
1152190749 17:78885854-78885876 CGGGGTGAGCCAGGGGAAGCTGG + Intronic
1152417872 17:80174766-80174788 CTGAGGACTCCCAGGGAAGCTGG + Intronic
1152638696 17:81440640-81440662 ATGGGTAACCCCAGGGCAGCCGG + Intronic
1153443826 18:5150619-5150641 CTGGGTGATCATAGAGAAGCAGG - Intronic
1153838929 18:8989051-8989073 CTGGGGAAATCAAGGGATGCTGG - Intergenic
1159111943 18:64069670-64069692 CTGGGCAATCCCCGGGAACCTGG + Intergenic
1160364335 18:78311633-78311655 CTCGGTTTCCCAAGGGAAGCGGG - Intergenic
1161378001 19:3950092-3950114 CTGGGTGGTCCCAGGGGAGCGGG - Intergenic
1163481732 19:17560506-17560528 CTGGGTATCCCCAGGGAAGGCGG + Intronic
1163497867 19:17657084-17657106 CTGTGGCTTCCAAGGGAAGCAGG - Intronic
1164386862 19:27778852-27778874 CTGAGTAGTCCAAGGGACACGGG - Intergenic
1165422287 19:35728182-35728204 CTGGGTAGCAGAAGGGAAGCCGG + Intronic
1166950901 19:46427620-46427642 GTGGGTAATGCAAGGGAGGGTGG - Intergenic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
925438670 2:3865144-3865166 CTGTGTAGGCCCAGGGAAGCAGG - Intergenic
925587210 2:5475649-5475671 TTGGGGAATCTCAGGGAAGCAGG - Intergenic
927973863 2:27323124-27323146 CTGCGTAATCCGAAGGACGCTGG - Intronic
929824936 2:45302670-45302692 CTGGGAAATCAGTGGGAAGCAGG + Intergenic
936743044 2:115538000-115538022 CTAGGTAATCCAAGGGAGCCAGG + Intronic
937387506 2:121449389-121449411 CTGGGGAATCTTAGGGAAGGTGG + Intronic
940205932 2:151201853-151201875 CTGGGAAATCCAAGAGAGCCAGG + Intergenic
940637116 2:156310947-156310969 CTGTGGCATCCAAGGGAAGCAGG + Intergenic
945768089 2:214004709-214004731 CTGGGTCATCCTAGGGATGCAGG + Intronic
945863050 2:215145713-215145735 CTGGGTCATCCAGATGAAGCAGG - Intergenic
946355773 2:219183390-219183412 CTGGGTGATCCAAGTGTAGTGGG + Exonic
948060686 2:235041627-235041649 CTGGCTAAACCACAGGAAGCTGG + Exonic
948627326 2:239277120-239277142 CTGGGTACACCAAGGTGAGCAGG - Intronic
1170838167 20:19902649-19902671 CTGGGTAATTCTAAGGAAGGTGG + Intronic
1171147488 20:22798132-22798154 CTGGGTTAACCCTGGGAAGCAGG - Intergenic
1172033471 20:31996740-31996762 CTGGGTCATCCAAGGGGAGACGG + Exonic
1173306826 20:41858482-41858504 CTGGGGTGTCCCAGGGAAGCAGG + Intergenic
1174625571 20:51911771-51911793 CTGGGGAGACCAAGGAAAGCAGG + Intergenic
1175212118 20:57366399-57366421 CTGGGGAATCCCAAGGGAGCAGG + Intronic
1182574587 22:31264374-31264396 CTGGGTAGCCCAAGTAAAGCAGG + Intronic
1183004658 22:34891086-34891108 CTGGGTAATTTAAGGGAAAGAGG - Intergenic
1183446912 22:37863283-37863305 TTGGGTAGTTCAAGGGGAGCAGG - Exonic
950171790 3:10843916-10843938 CTGGGAACTCCAAGGTAGGCTGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951613560 3:24519280-24519302 CTGGGTATCCCAAGGGAACCTGG + Intergenic
952262337 3:31752693-31752715 CTGGGTAAAGCAAGGGCTGCGGG + Intronic
955169211 3:56546821-56546843 CTTGGTAATGCGAGGAAAGCAGG + Intergenic
958702923 3:97616167-97616189 CTGGAAAATCCAAGGCAACCAGG + Intronic
960046744 3:113205899-113205921 CTGGGTATTGCAAGGGCTGCTGG - Intergenic
962042880 3:131725484-131725506 CTGGGTCTTCCTGGGGAAGCTGG - Intronic
962248152 3:133815013-133815035 CTGGGGAAGTCAAGGTAAGCTGG - Intronic
964447401 3:156774460-156774482 CTGTGTACTCAAAGAGAAGCTGG + Intergenic
965841576 3:172911416-172911438 CTGGGGAATCAAAGAGAAGTTGG - Intronic
967230019 3:187328933-187328955 CTGTGACATCCAAGAGAAGCTGG + Intergenic
967269263 3:187719490-187719512 AGGGGTAATCCCAGAGAAGCGGG - Intronic
968294961 3:197569327-197569349 GTGGATAATCCAACAGAAGCTGG + Intronic
968704236 4:2070583-2070605 CTGCGTAATTGAAGGGAAGAAGG + Intergenic
970861787 4:20712585-20712607 CTTGGTATCCCAAGGGAAACTGG - Intronic
971504872 4:27355654-27355676 CAGGGTAATCAAAGAGAAACGGG - Intergenic
973155253 4:46943691-46943713 CTGGGTAAGCCAAGTGAATATGG - Intronic
977845241 4:101759931-101759953 ATGACTAATCCAAGGGAACCTGG - Intronic
978555009 4:109970536-109970558 CAGGATAATCCATGGGAAACAGG + Intronic
978619221 4:110622421-110622443 CTCGGTGCTCCAAGTGAAGCGGG + Exonic
980302611 4:131013911-131013933 ATAGGTAATCCAAGGAAGGCTGG + Intergenic
980881060 4:138710259-138710281 CTGGGTAATGTAATGGAGGCTGG - Intergenic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
984822427 4:183893471-183893493 CTGGGTGATGCAAGTGATGCTGG + Intronic
991046138 5:62224616-62224638 CTGGGAAGTCCAAGGGAAAAAGG + Intergenic
992424329 5:76640561-76640583 CTTGGCAGTCCGAGGGAAGCGGG + Intronic
993217738 5:85047820-85047842 ATGGGGAATCCAAGGGACCCAGG + Intergenic
998301724 5:141028354-141028376 CTGGGTAATTCAAGGAGAGAAGG - Intergenic
999775780 5:154812087-154812109 CTGGGTATATCAAGGGAAGTTGG + Intronic
999858411 5:155619845-155619867 CTGGGTAAGCCTGGGGCAGCCGG - Intergenic
1001641895 5:173250219-173250241 CTGGCTACTCCCAGGGAAGAAGG + Intergenic
1003084766 6:3052709-3052731 CTGGGAAAGCCCAGGGAAGCAGG + Intergenic
1003122750 6:3331187-3331209 TGGGGTAATACAGGGGAAGCTGG - Intronic
1003459817 6:6319603-6319625 CTGGGTAATCCAGGGGATCAAGG - Intronic
1003827014 6:9964346-9964368 AAGGGTAATCAAAGGGAAACTGG - Intronic
1004519913 6:16352159-16352181 CTGGTTAACCCAAGGGATGGTGG + Intronic
1005562366 6:27053921-27053943 CAGGGAATTCCCAGGGAAGCAGG - Intergenic
1007202108 6:40118340-40118362 CTGGGTAAGCCAATGGGACCAGG + Intergenic
1010628584 6:78169047-78169069 CTGGGAAATCCAAGAGACGGTGG - Intergenic
1012046628 6:94283800-94283822 CTGGGTGATCCATAGGAAGCAGG - Intergenic
1012964225 6:105656135-105656157 CTGGGCAATGAAAGGGTAGCTGG - Intergenic
1015255607 6:131176314-131176336 CTGGGTAATTCTAGGAAAGAAGG - Intronic
1016070291 6:139730605-139730627 TTGGGAAATTCCAGGGAAGCTGG + Intergenic
1027535404 7:79393835-79393857 CTGGGTCATTTTAGGGAAGCGGG - Intronic
1028446942 7:90935076-90935098 CTGTGTCATCCAAGGGCAGCAGG + Intronic
1032304608 7:130720857-130720879 TGGGGCACTCCAAGGGAAGCAGG - Intergenic
1034499299 7:151439783-151439805 GTGACAAATCCAAGGGAAGCTGG - Intronic
1035026509 7:155830139-155830161 CTGAGAGATGCAAGGGAAGCCGG + Intergenic
1036199683 8:6758327-6758349 CTGTGAAATCAAAGAGAAGCAGG - Exonic
1036206212 8:6807296-6807318 CTGGGTGAGTCTAGGGAAGCCGG - Intergenic
1038378825 8:27072671-27072693 GTTGGTAATCCAAGGGATACTGG + Intergenic
1041623752 8:60001381-60001403 CTGGAAAATCCAAGGCAAGTAGG + Intergenic
1045279931 8:100741446-100741468 CTGGGCATCCCAAGGGAAGGGGG + Intergenic
1050259552 9:3827259-3827281 TTTGGTTTTCCAAGGGAAGCTGG + Intronic
1050615330 9:7395808-7395830 CTGGGTAAACTAAGGGAAACTGG + Intergenic
1055001392 9:71453512-71453534 CAGAGGAATCCGAGGGAAGCTGG - Intergenic
1057382124 9:94577697-94577719 ATAGGTAATCCAAGGAAAGCTGG - Intronic
1059436700 9:114281496-114281518 CTGGGGACTCCAAGGAAAGTGGG + Intronic
1060601685 9:124882361-124882383 CTGGGCAATCCAACGTTAGCTGG - Intronic
1061677964 9:132229082-132229104 CCGGGGACTCCCAGGGAAGCAGG - Intronic
1061754880 9:132805244-132805266 CTGGGAAGTCCAAGGAGAGCCGG - Intronic
1188934363 X:36155017-36155039 CTGGGAAGTCCAAGGGATCCAGG + Intergenic
1189546102 X:42044282-42044304 CTTGGAAACTCAAGGGAAGCAGG - Intergenic
1191088871 X:56598680-56598702 CTGGGGAATCCAAGGGGACATGG + Intergenic
1192782849 X:74311745-74311767 TTGGGAAATCCAAGGGTAGAAGG + Intergenic
1196438448 X:115695366-115695388 GTGGGTATTACGAGGGAAGCGGG - Intergenic
1196981886 X:121223420-121223442 AATGGTGATCCAAGGGAAGCGGG + Intergenic
1198151407 X:133913968-133913990 TTGTGTAATACAAGGGAAGCAGG - Intronic