ID: 1084287860

View in Genome Browser
Species Human (GRCh38)
Location 11:68143270-68143292
Sequence CCTTGGCAGCAGGAGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084287851_1084287860 9 Left 1084287851 11:68143238-68143260 CCCTGCTGATGGTGGCCATCCTT No data
Right 1084287860 11:68143270-68143292 CCTTGGCAGCAGGAGCTGGATGG No data
1084287853_1084287860 -6 Left 1084287853 11:68143253-68143275 CCATCCTTTCTTCCTCACCTTGG No data
Right 1084287860 11:68143270-68143292 CCTTGGCAGCAGGAGCTGGATGG No data
1084287845_1084287860 24 Left 1084287845 11:68143223-68143245 CCCCACTGTCGCCAGCCCTGCTG No data
Right 1084287860 11:68143270-68143292 CCTTGGCAGCAGGAGCTGGATGG No data
1084287852_1084287860 8 Left 1084287852 11:68143239-68143261 CCTGCTGATGGTGGCCATCCTTT No data
Right 1084287860 11:68143270-68143292 CCTTGGCAGCAGGAGCTGGATGG No data
1084287846_1084287860 23 Left 1084287846 11:68143224-68143246 CCCACTGTCGCCAGCCCTGCTGA No data
Right 1084287860 11:68143270-68143292 CCTTGGCAGCAGGAGCTGGATGG No data
1084287855_1084287860 -10 Left 1084287855 11:68143257-68143279 CCTTTCTTCCTCACCTTGGCAGC No data
Right 1084287860 11:68143270-68143292 CCTTGGCAGCAGGAGCTGGATGG No data
1084287847_1084287860 22 Left 1084287847 11:68143225-68143247 CCACTGTCGCCAGCCCTGCTGAT No data
Right 1084287860 11:68143270-68143292 CCTTGGCAGCAGGAGCTGGATGG No data
1084287850_1084287860 13 Left 1084287850 11:68143234-68143256 CCAGCCCTGCTGATGGTGGCCAT No data
Right 1084287860 11:68143270-68143292 CCTTGGCAGCAGGAGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084287860 Original CRISPR CCTTGGCAGCAGGAGCTGGA TGG Intergenic
No off target data available for this crispr