ID: 1084288524

View in Genome Browser
Species Human (GRCh38)
Location 11:68146973-68146995
Sequence GAGTAGCCCGAGGCTCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084288524_1084288531 9 Left 1084288524 11:68146973-68146995 CCACTTGGAGCCTCGGGCTACTC No data
Right 1084288531 11:68147005-68147027 GCAGCGATGTGGAACCTTGTTGG No data
1084288524_1084288527 -2 Left 1084288524 11:68146973-68146995 CCACTTGGAGCCTCGGGCTACTC No data
Right 1084288527 11:68146994-68147016 TCCGCCCAGGAGCAGCGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084288524 Original CRISPR GAGTAGCCCGAGGCTCCAAG TGG (reversed) Intergenic
No off target data available for this crispr