ID: 1084292226

View in Genome Browser
Species Human (GRCh38)
Location 11:68180802-68180824
Sequence CCACTCCATTTAAAAACCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084292221_1084292226 -1 Left 1084292221 11:68180780-68180802 CCTTTCTTAAAATATCCCGCTCC 0: 1
1: 0
2: 0
3: 15
4: 95
Right 1084292226 11:68180802-68180824 CCACTCCATTTAAAAACCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 163
1084292220_1084292226 0 Left 1084292220 11:68180779-68180801 CCCTTTCTTAAAATATCCCGCTC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1084292226 11:68180802-68180824 CCACTCCATTTAAAAACCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084292226 Original CRISPR CCACTCCATTTAAAAACCAG AGG Intronic
900622702 1:3594694-3594716 CCATTCCTTTTACAAAGCAGAGG + Intronic
901847130 1:11990613-11990635 CCCTTCCATTTAAACAACAGGGG - Intronic
903535381 1:24063203-24063225 CAACTCCACTGAAAATCCAGGGG - Exonic
906302389 1:44692459-44692481 CCACTGGATCTAAAATCCAGTGG - Intronic
907216218 1:52866605-52866627 CCTCTGCATTTAATAACCAAAGG - Intronic
908816491 1:68040744-68040766 CTACTCCAGTTAAACACCAATGG - Intergenic
916314483 1:163433753-163433775 ACACTCCATTTAAAATTCAAAGG - Intergenic
917114894 1:171593134-171593156 ACACTCCATTTAAAAAAAAGGGG - Exonic
918260508 1:182791193-182791215 CCTCTCATTTTAAAAACCAGGGG - Intronic
919112520 1:193238555-193238577 CCATTCCAGTTGATAACCAGAGG - Intronic
920453504 1:206079209-206079231 AAAATACATTTAAAAACCAGTGG + Intronic
920666353 1:207965390-207965412 CCATTCCCTTCAAAAACAAGAGG - Intergenic
920739343 1:208565485-208565507 CCTTTCCCTTTAAAATCCAGAGG + Intergenic
923216996 1:231857495-231857517 CCATGCCATTTAAACACCATGGG + Intronic
1065105655 10:22381237-22381259 CCACCCCATTTTACAACCATAGG - Intronic
1069284495 10:66695825-66695847 CCACTGCATTGAAAATCCTGGGG + Intronic
1071455776 10:85850440-85850462 CCACTCCATATAAAGACCAAGGG - Intronic
1072738610 10:97896197-97896219 CCTCTCCATGCAAAGACCAGGGG - Intronic
1074730172 10:116363538-116363560 TCAGTCCATGGAAAAACCAGTGG + Intronic
1077257349 11:1592703-1592725 CCATTCTCTTCAAAAACCAGGGG - Intergenic
1077717903 11:4600084-4600106 CCACTTATTTTAAAAAGCAGAGG - Exonic
1078972007 11:16425034-16425056 CCACTCAACTTTAGAACCAGAGG + Intronic
1079483078 11:20903934-20903956 CCATACCATTTATAACCCAGTGG + Intronic
1079574217 11:21983322-21983344 CTTTCCCATTTAAAAACCAGAGG - Intergenic
1080282639 11:30575988-30576010 CCAATTCATTTGAAAAGCAGTGG - Intronic
1080904900 11:36533690-36533712 CATCCCCATTTAAAAAACAGAGG - Intronic
1081076445 11:38679861-38679883 CCAATCCATTTTAAAATCAGAGG + Intergenic
1081247329 11:40784398-40784420 CCAATCCATTTAAACAGCTGAGG - Intronic
1082927155 11:58561753-58561775 GGACTCTAGTTAAAAACCAGTGG - Intronic
1083843781 11:65319434-65319456 CAACCCTATTTAAAAATCAGAGG - Intronic
1084292226 11:68180802-68180824 CCACTCCATTTAAAAACCAGAGG + Intronic
1086956489 11:92939051-92939073 CTATTCTATTTAATAACCAGAGG - Intergenic
1087469673 11:98556428-98556450 TCATTCCATTTAGAAACTAGTGG + Intergenic
1089345388 11:117787998-117788020 CAAGTCCATTCAAAACCCAGAGG + Intronic
1090009086 11:123030027-123030049 TGACCCCATTTAAATACCAGTGG - Intergenic
1090225203 11:125066890-125066912 CATCTCCAGTTGAAAACCAGTGG + Intronic
1095116264 12:38356049-38356071 ATACTCCTTTTAATAACCAGAGG - Intergenic
1098154103 12:67579405-67579427 GCACTTCATCTAAAATCCAGAGG + Intergenic
1099275765 12:80574362-80574384 ATACTCCATTTAAAAGTCAGAGG - Intronic
1099766384 12:86991678-86991700 CCACTCCATTTTGATACCAAAGG - Intergenic
1101512587 12:105406482-105406504 CCATTCCATTTTAACACCATTGG + Intergenic
1103174254 12:118848243-118848265 CCACCCCCTCTGAAAACCAGTGG - Intergenic
1105275678 13:18922184-18922206 CCTATCCATTTAGAATCCAGAGG + Intergenic
1106956843 13:34948650-34948672 CCACTCCATTTCAAAATCTAAGG - Intronic
1109404594 13:61880044-61880066 CTAGTCCATTTAAAAACAAATGG - Intergenic
1109777802 13:67065654-67065676 CTTCTTCATTTCAAAACCAGTGG - Intronic
1111402948 13:87764874-87764896 CCACGCCTTTTAAAAAGCAGGGG + Intergenic
1117760536 14:59022639-59022661 CCACTCCATGTACAAAAGAGTGG + Intergenic
1117862912 14:60111298-60111320 ACACTACATTTATGAACCAGAGG + Intronic
1118025873 14:61768149-61768171 ACACTGCATTTAAAAAGCAAAGG - Intronic
1125369018 15:38950012-38950034 CCACTCTTTTGAAACACCAGGGG - Intergenic
1133755225 16:8757637-8757659 CAACTCTCTTTAAAAACCAAAGG - Intronic
1136171464 16:28492202-28492224 CCGCTCCAGTTTAAAACCTGCGG - Exonic
1136669741 16:31845623-31845645 CAACTCCATTTAGAATCCACTGG - Intergenic
1136706796 16:32196990-32197012 CTACTCAATTTAAAAACAAATGG + Intergenic
1136761115 16:32732427-32732449 CTACTCAATTTAAAAACAAATGG - Intergenic
1136806988 16:33137959-33137981 CTACTCAATTTAAAAACAAATGG + Intergenic
1137515794 16:49143012-49143034 TCAATACATTTGAAAACCAGTGG - Intergenic
1203063267 16_KI270728v1_random:992744-992766 CTACTCAATTTAAAAACAAATGG - Intergenic
1143546067 17:7596478-7596500 CCACTCCTTCCAAATACCAGTGG + Intronic
1144170312 17:12653542-12653564 CCAGACCAATTACAAACCAGGGG - Intergenic
1144281252 17:13729248-13729270 CCAGGCCAGTTAAAAACAAGGGG - Intergenic
1144328187 17:14201894-14201916 CCAGTCACTTTAAAATCCAGAGG + Intronic
1144775193 17:17781755-17781777 ACACACCATTTAAACAGCAGCGG - Intronic
1147699445 17:42383510-42383532 CTACTCCTTTTAAAAACTGGAGG + Intronic
1148449783 17:47769204-47769226 CCACTCAATTTAAACAAAAGGGG - Intergenic
1149171587 17:53818643-53818665 CAACCCCATTTAATAAGCAGGGG + Intergenic
1151088672 17:71410228-71410250 CAACTCCATTTAAGAAAAAGTGG - Intergenic
1153822002 18:8839990-8840012 CCACTCCACTTCAAAGACAGAGG + Intergenic
1153996410 18:10445842-10445864 ACTCTTCATTTGAAAACCAGTGG - Intergenic
1154467297 18:14659318-14659340 CCTATCCATTTAGAATCCAGAGG + Intergenic
1155564436 18:27118217-27118239 CAACTCCATTTAAAAATAAATGG - Intronic
1156130709 18:33970304-33970326 CCAGTTTATTTAAAAACCAAAGG - Intronic
1157679278 18:49591193-49591215 CCTCTCCATTTGGAACCCAGTGG + Exonic
1157999452 18:52599280-52599302 CAGTTCCATCTAAAAACCAGGGG + Intronic
1159666779 18:71170959-71170981 ACACTCCATTTAAAAAAAAGGGG - Intergenic
1160043069 18:75362845-75362867 ACCCTCTATTTAAAAACCAATGG + Intergenic
1164031274 19:21408000-21408022 CCACTCCACTACAAACCCAGAGG - Intronic
924984388 2:255839-255861 TTACTCCTTTTAAAAACAAGTGG + Intronic
925553002 2:5096372-5096394 CCACTCCAGTGAAAAATCAAAGG - Intergenic
926792717 2:16591471-16591493 CCTCTTCTTTTAGAAACCAGAGG - Intronic
931056070 2:58472834-58472856 CCTCTACTTTTAAAAACCACAGG + Intergenic
931310980 2:61080345-61080367 CCATTCCAGTTAGGAACCAGTGG - Intronic
932655991 2:73611515-73611537 CCACCACAGTTAAGAACCAGGGG - Intergenic
935086393 2:99849756-99849778 ACATTATATTTAAAAACCAGAGG - Intronic
935825374 2:106942727-106942749 ACACTCCAATTAAAAGGCAGAGG + Intergenic
936453087 2:112647781-112647803 CCAATCGATTTCAAACCCAGTGG + Intronic
936690362 2:114880595-114880617 CCACACCACTTAAAATCCAAAGG - Intronic
940233292 2:151482382-151482404 CCTCTGGATTTAGAAACCAGTGG - Intronic
940322632 2:152392835-152392857 CCAATCCAGTTAGAAGCCAGAGG - Intronic
941862423 2:170297392-170297414 GCTCCCCATTTAAAAAACAGTGG + Intronic
944120108 2:196231479-196231501 ACACTTTATTTACAAACCAGAGG - Intronic
944739995 2:202602690-202602712 CCACTCCATGTAACAACCAGGGG - Intergenic
944931062 2:204520125-204520147 GCAAGCCATTTAAAAACCAAAGG - Intergenic
945816548 2:214611757-214611779 CCACCTCATTAAAAAACTAGTGG + Intergenic
947520206 2:230839743-230839765 CAACTGCATTCGAAAACCAGCGG + Intergenic
947773372 2:232688380-232688402 CCACTCCTTCCCAAAACCAGTGG + Intergenic
947991745 2:234493809-234493831 CCAGCCCATTTAGAAATCAGTGG + Exonic
948736961 2:240015112-240015134 CCACTGTATTTACAAACCAAAGG + Intronic
1171011230 20:21510459-21510481 CCACTCCTTTTCAAAATCTGCGG - Intergenic
1172069240 20:32244416-32244438 ACACAACATTTAAAAGCCAGAGG - Intergenic
1175729601 20:61345366-61345388 ACACTGCTTTTAAAAACCAGAGG - Intronic
1177868403 21:26540403-26540425 GTACTGCTTTTAAAAACCAGGGG + Intronic
1181849057 22:25736746-25736768 CCACCCCATTTGAGAACCACTGG + Intergenic
1184026097 22:41857780-41857802 TCACTCCACTCAAACACCAGGGG - Intronic
954449621 3:50564617-50564639 CCACTCCCTGTAAGAACCACAGG + Intronic
954840384 3:53506343-53506365 CCACAACAGTTATAAACCAGGGG - Intronic
956803678 3:72787676-72787698 CCAATGCATTTTTAAACCAGTGG - Intronic
959931618 3:111989571-111989593 CCACTTCAGCTAATAACCAGTGG + Intronic
961150240 3:124631766-124631788 TCACTCCAGGTAAAAGCCAGAGG + Intronic
966755853 3:183370693-183370715 CTTCTCTATTTAAAAACTAGGGG - Intronic
967205992 3:187122186-187122208 CCACTCCATTTAAAGATCTTGGG + Intronic
968544171 4:1188401-1188423 ACACTCCAGTTAAAAAGCAGCGG + Intronic
971093946 4:23376627-23376649 CCAATGCATTTGAAAACCAGAGG - Intergenic
971731877 4:30394650-30394672 CCACTACAATTAGAAATCAGAGG + Intergenic
972460945 4:39301565-39301587 CCACTCCATTTTTAATCCATAGG + Intronic
975431068 4:74291389-74291411 TCTCTGTATTTAAAAACCAGTGG + Intronic
976952175 4:90847256-90847278 CCATTCCATTTAAAGAACACTGG + Intronic
979571484 4:122231708-122231730 GCACCCCATATAAAATCCAGAGG - Intronic
980711545 4:136575019-136575041 CCAGTCCATTTACAAACTCGAGG + Intergenic
984675439 4:182542179-182542201 GCACTCAATTTACAAACAAGGGG - Intronic
986068668 5:4260916-4260938 CCCCTCCTATAAAAAACCAGTGG - Intergenic
986774941 5:11005851-11005873 CAAATGCATTTAAAAACCATGGG + Intronic
988812697 5:34801360-34801382 ACACTGTATTTAAAAACTAGTGG - Intronic
993689262 5:90979079-90979101 CCACTCACTTTAAATGCCAGTGG - Intronic
995833931 5:116381864-116381886 CCACATCATTCAAAGACCAGGGG - Intronic
996741434 5:126802871-126802893 GAACTCCATTTAAAAAAAAGTGG + Intronic
996804939 5:127444013-127444035 ACACCCCAATTGAAAACCAGGGG - Intronic
997000932 5:129761272-129761294 CCAGTCCATTCAGAAAACAGAGG - Intronic
997974489 5:138432343-138432365 CCAATCCATTTCAAGAGCAGAGG - Intronic
1001452454 5:171836945-171836967 CCACGCTATTTAAAAAGAAGGGG + Intergenic
1001842180 5:174887235-174887257 CCACTTCATTTAGAAAGGAGAGG - Intergenic
1004156791 6:13176081-13176103 CGTCTCCATGTAGAAACCAGAGG + Intronic
1005301188 6:24472390-24472412 CCACTCCATTCAAAATTGAGTGG + Intronic
1007447657 6:41919624-41919646 CTTCTCCATTTAAAGAGCAGGGG + Intronic
1009921770 6:70070920-70070942 CCACTCAATTAAAATACAAGAGG - Intronic
1010504365 6:76638681-76638703 CAATTCAATTTAAAAAACAGTGG - Intergenic
1013810283 6:114037316-114037338 ACACTCCATTTAAAGAAAAGGGG - Intergenic
1014815245 6:125928168-125928190 CCACTCCACTTAAAGACCTTGGG - Exonic
1016362491 6:143283129-143283151 CCACTAAATTTCAAAACCAAGGG + Intronic
1017883451 6:158578767-158578789 ACTCTCCAATTAAAAAGCAGAGG + Intronic
1018759696 6:166881965-166881987 TCACTCCAATTAAAAAGCAAAGG + Intronic
1019669511 7:2269926-2269948 CCACTCCATCCACAGACCAGGGG + Intronic
1021670721 7:23032496-23032518 CCAGTACATAAAAAAACCAGTGG - Intergenic
1023458655 7:40369265-40369287 CCACTCCACTTCCAAAGCAGAGG - Intronic
1024942211 7:54775058-54775080 CCACTGCCTTGAAGAACCAGAGG + Intergenic
1025804396 7:64816854-64816876 CCTCTCCATTACAAACCCAGAGG - Intronic
1028481216 7:91307652-91307674 ACACTCCAATTAAAAGCCAGAGG + Intergenic
1030086080 7:105816853-105816875 CCACTGAATTTAGAAAACAGGGG + Intronic
1032110202 7:129069370-129069392 CCACTGCATTTAGACCCCAGAGG + Intergenic
1032119050 7:129143372-129143394 CCACTCCAACTGAAAACCATGGG + Intergenic
1033887448 7:145966032-145966054 CCACAACATTTGAAAAGCAGGGG + Intergenic
1034080351 7:148271454-148271476 CCACCCCAGTTGAAAACCACAGG + Intronic
1034755041 7:153608539-153608561 ACACTCTATTTAAAAGGCAGAGG + Intergenic
1038579385 8:28734406-28734428 CCACATCATTTGAAAACCACTGG + Intronic
1040745143 8:50633402-50633424 CCACTCTGGGTAAAAACCAGTGG + Intronic
1042570969 8:70164328-70164350 CCTTTCCATTTAAAAAACACTGG + Intronic
1042761728 8:72278421-72278443 CCACCCCATTGAAAAATCAGAGG + Intergenic
1043287612 8:78553714-78553736 CCACTCTATTTTAAAACAACTGG + Intronic
1046502611 8:115097652-115097674 CCACCCAAGTTAAAAACCAGAGG - Intergenic
1047344827 8:124017215-124017237 CCCCACCATTTAAAAACAATAGG - Intronic
1047464436 8:125098867-125098889 CCATTCCATCTAAATACCATTGG - Intronic
1047806121 8:128361933-128361955 CCCATACATTTAAACACCAGAGG - Intergenic
1047806822 8:128369799-128369821 TCACTACATTTAAGAACCACTGG - Intergenic
1047873867 8:129113948-129113970 CCTCTCCTTTCAAAAGCCAGTGG + Intergenic
1048298075 8:133229989-133230011 TCACTCCATTTGAAATTCAGTGG + Exonic
1048732963 8:137464185-137464207 CCACTTCATTTTACAACCACAGG - Intergenic
1060350517 9:122854753-122854775 TCCCTCCATTTAACAACCATGGG - Intronic
1061134814 9:128727661-128727683 GCTCTCCTTTTAAAAACCTGTGG - Intergenic
1186513979 X:10152334-10152356 CCACTCCACTGCAAAAGCAGAGG + Intergenic
1188682844 X:33032487-33032509 CCTCTTCATTTAAAAAAGAGAGG + Intronic
1189504887 X:41602902-41602924 CCCCTCCAGTTAGAAAACAGTGG + Intronic
1190641327 X:52484060-52484082 CCACCCCACTGAAAACCCAGAGG + Intergenic
1190646345 X:52528805-52528827 CCACCCCACTGAAAACCCAGAGG - Intergenic
1191307235 X:59015196-59015218 CAACTTCATATAAAAACCAGAGG + Intergenic
1191329162 X:59308672-59308694 CAACTTCATATAAAAACCAGAGG + Intergenic
1191340513 X:59460393-59460415 CAACTTCATATAAAAACCAGAGG + Intergenic
1191354340 X:59645213-59645235 CAACTTCATATAAAAACCAGAGG + Intergenic
1191391677 X:60144073-60144095 CAACTTCATATAAAAACCAGAGG + Intergenic
1191409747 X:60386599-60386621 CAACTTCATATAAAAACCAGAGG + Intergenic
1191473687 X:61242570-61242592 CAACTTCATATAAAAACCAGAGG + Intergenic
1191505615 X:61669455-61669477 CAACTTCATATAAAAACCAGAGG + Intergenic
1194905585 X:99572595-99572617 CCACAACAGTTAAAACCCAGAGG + Intergenic
1197348324 X:125350830-125350852 CCCCTCCATTTAGAAAGGAGAGG + Intergenic
1197658387 X:129142996-129143018 CCACTTCATTTAACAAACATTGG + Intergenic