ID: 1084296339

View in Genome Browser
Species Human (GRCh38)
Location 11:68214952-68214974
Sequence CCCTTGCCACAGAGAGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084296327_1084296339 15 Left 1084296327 11:68214914-68214936 CCAGCCAGTGTCAAAGCCCTGGG No data
Right 1084296339 11:68214952-68214974 CCCTTGCCACAGAGAGGAGGCGG No data
1084296334_1084296339 -1 Left 1084296334 11:68214930-68214952 CCCTGGGAGGGGAGAGAGGCTGC No data
Right 1084296339 11:68214952-68214974 CCCTTGCCACAGAGAGGAGGCGG No data
1084296330_1084296339 11 Left 1084296330 11:68214918-68214940 CCAGTGTCAAAGCCCTGGGAGGG No data
Right 1084296339 11:68214952-68214974 CCCTTGCCACAGAGAGGAGGCGG No data
1084296335_1084296339 -2 Left 1084296335 11:68214931-68214953 CCTGGGAGGGGAGAGAGGCTGCC No data
Right 1084296339 11:68214952-68214974 CCCTTGCCACAGAGAGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084296339 Original CRISPR CCCTTGCCACAGAGAGGAGG CGG Intergenic
No off target data available for this crispr