ID: 1084301365

View in Genome Browser
Species Human (GRCh38)
Location 11:68254712-68254734
Sequence TTCACCAGTGCTGCGTGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084301365_1084301370 -3 Left 1084301365 11:68254712-68254734 CCGGAGCACGCAGCACTGGTGAA No data
Right 1084301370 11:68254732-68254754 GAAGTTGGGGTTCAGGAGTCAGG No data
1084301365_1084301373 6 Left 1084301365 11:68254712-68254734 CCGGAGCACGCAGCACTGGTGAA No data
Right 1084301373 11:68254741-68254763 GTTCAGGAGTCAGGTGGACTGGG No data
1084301365_1084301369 -10 Left 1084301365 11:68254712-68254734 CCGGAGCACGCAGCACTGGTGAA No data
Right 1084301369 11:68254725-68254747 CACTGGTGAAGTTGGGGTTCAGG No data
1084301365_1084301371 0 Left 1084301365 11:68254712-68254734 CCGGAGCACGCAGCACTGGTGAA No data
Right 1084301371 11:68254735-68254757 GTTGGGGTTCAGGAGTCAGGTGG No data
1084301365_1084301372 5 Left 1084301365 11:68254712-68254734 CCGGAGCACGCAGCACTGGTGAA No data
Right 1084301372 11:68254740-68254762 GGTTCAGGAGTCAGGTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084301365 Original CRISPR TTCACCAGTGCTGCGTGCTC CGG (reversed) Intergenic
No off target data available for this crispr