ID: 1084302713

View in Genome Browser
Species Human (GRCh38)
Location 11:68261903-68261925
Sequence GCTCCTGGGTGTTGGCCCAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084302705_1084302713 5 Left 1084302705 11:68261875-68261897 CCGTGGCTGGCATCTTAGTGCCC 0: 1
1: 1
2: 1
3: 18
4: 147
Right 1084302713 11:68261903-68261925 GCTCCTGGGTGTTGGCCCAGTGG 0: 1
1: 1
2: 0
3: 21
4: 291
1084302702_1084302713 30 Left 1084302702 11:68261850-68261872 CCTTGGGTGCTGGGCTGGCACGA 0: 1
1: 0
2: 1
3: 22
4: 180
Right 1084302713 11:68261903-68261925 GCTCCTGGGTGTTGGCCCAGTGG 0: 1
1: 1
2: 0
3: 21
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084302713 Original CRISPR GCTCCTGGGTGTTGGCCCAG TGG Exonic