ID: 1084303411

View in Genome Browser
Species Human (GRCh38)
Location 11:68265898-68265920
Sequence CTGCCTACAGCTATGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084303411_1084303420 -1 Left 1084303411 11:68265898-68265920 CCCAGCTGCATAGCTGTAGGCAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1084303420 11:68265920-68265942 GACTGGGGCTTTGGGGTGCTGGG 0: 1
1: 0
2: 2
3: 37
4: 301
1084303411_1084303418 -8 Left 1084303411 11:68265898-68265920 CCCAGCTGCATAGCTGTAGGCAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1084303418 11:68265913-68265935 GTAGGCAGACTGGGGCTTTGGGG 0: 1
1: 0
2: 0
3: 14
4: 181
1084303411_1084303417 -9 Left 1084303411 11:68265898-68265920 CCCAGCTGCATAGCTGTAGGCAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1084303417 11:68265912-68265934 TGTAGGCAGACTGGGGCTTTGGG 0: 1
1: 0
2: 1
3: 13
4: 184
1084303411_1084303422 23 Left 1084303411 11:68265898-68265920 CCCAGCTGCATAGCTGTAGGCAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1084303422 11:68265944-68265966 GAGCTGCCCATTGGTCACTCAGG 0: 1
1: 0
2: 1
3: 14
4: 126
1084303411_1084303419 -2 Left 1084303411 11:68265898-68265920 CCCAGCTGCATAGCTGTAGGCAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1084303419 11:68265919-68265941 AGACTGGGGCTTTGGGGTGCTGG 0: 1
1: 1
2: 3
3: 35
4: 365
1084303411_1084303423 24 Left 1084303411 11:68265898-68265920 CCCAGCTGCATAGCTGTAGGCAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1084303423 11:68265945-68265967 AGCTGCCCATTGGTCACTCAGGG 0: 1
1: 0
2: 1
3: 6
4: 141
1084303411_1084303421 14 Left 1084303411 11:68265898-68265920 CCCAGCTGCATAGCTGTAGGCAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1084303421 11:68265935-68265957 GTGCTGGGTGAGCTGCCCATTGG 0: 1
1: 0
2: 2
3: 19
4: 164
1084303411_1084303416 -10 Left 1084303411 11:68265898-68265920 CCCAGCTGCATAGCTGTAGGCAG 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1084303416 11:68265911-68265933 CTGTAGGCAGACTGGGGCTTTGG 0: 1
1: 0
2: 0
3: 15
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084303411 Original CRISPR CTGCCTACAGCTATGCAGCT GGG (reversed) Intronic
900144002 1:1150219-1150241 CTGCAAACAGGTGTGCAGCTTGG - Intergenic
901817222 1:11801190-11801212 CTGCACAAAGCTAAGCAGCTGGG - Exonic
902058428 1:13621427-13621449 CTGAGTACAGATATCCAGCTGGG + Intergenic
907314709 1:53560902-53560924 CTGCCCACAGCCAGGCAGCCAGG + Intronic
908068826 1:60436067-60436089 CTGGTTAAAGCTATGCAGTTTGG + Intergenic
912947508 1:114097175-114097197 CTGGCTAAAGCTGTGGAGCTGGG - Intronic
917130802 1:171740881-171740903 CTGCCTACTGCTTTGCTGATGGG - Intronic
920909143 1:210197959-210197981 CTGCCAACAGCCAGGGAGCTTGG + Intergenic
921150554 1:212398992-212399014 CTACCCACAGCTATTTAGCTTGG + Intronic
923685259 1:236149060-236149082 TTGCCTACAGCTCTGAACCTAGG + Intronic
924170324 1:241332698-241332720 TTGCTTACAGATATGCAGATGGG - Intronic
924740464 1:246791703-246791725 CTGCTTCCAGCTCTCCAGCTGGG - Intergenic
1063426210 10:5951995-5952017 CTGCCTGCAGCCATGAAGCTTGG - Intronic
1064289414 10:14020222-14020244 CTGGCTGCTGCTATGCTGCTGGG - Intronic
1067475773 10:46564938-46564960 CTGCCTGCAGGTAAGCAGCCTGG - Intergenic
1067618965 10:47776837-47776859 CTGCCTGCAGGTAAGCAGCCTGG + Intergenic
1071123636 10:82309583-82309605 TTCCCTGCAGCTAGGCAGCTTGG - Intronic
1074312809 10:112336811-112336833 CTACCTACAAATATGCAACTTGG - Intergenic
1074630563 10:115250471-115250493 CTGCATGCAACTCTGCAGCTAGG - Intronic
1077243254 11:1522877-1522899 CGGCCTCCAGCCATGTAGCTTGG - Intergenic
1080859107 11:36137807-36137829 CTGCCTTCATCTCTGCAGCAGGG - Intronic
1084303411 11:68265898-68265920 CTGCCTACAGCTATGCAGCTGGG - Intronic
1084672505 11:70615626-70615648 TTGCTTACAGATATGCAGCAAGG - Intronic
1087417264 11:97872392-97872414 CTGGCAACAGCCATGCAGCATGG - Intergenic
1088373491 11:109116472-109116494 CTGCCTACAAAGAGGCAGCTAGG - Intergenic
1090358925 11:126159665-126159687 CTCCCCACAGCTTTTCAGCTGGG + Intergenic
1092974497 12:13731174-13731196 GTGCCTACAGCTATGCAGTCTGG - Intronic
1094627466 12:32137694-32137716 CTTTCTACAGCCATGCTGCTGGG - Intronic
1095365755 12:41403120-41403142 CTGCCTATTGCTATGAAGCTGGG - Intronic
1101895294 12:108751946-108751968 CTGCCTGAAGCTCTGAAGCTGGG - Intergenic
1103731687 12:123032086-123032108 CTTCCTGCAGCTGTGCAGCCAGG - Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1109397274 13:61776926-61776948 CTGCTTACAGATAGGCAGCAAGG + Intergenic
1112576964 13:100644537-100644559 CAGCTTGCAGCTATACAGCTGGG + Intronic
1113559363 13:111265860-111265882 CTGCCCACAGCTCTGGAGGTTGG - Intronic
1114129282 14:19771404-19771426 CTGCCCACAGCTCAGCAACTGGG - Intronic
1114545018 14:23493502-23493524 TTGCCAAAAGCTATGCAGCTAGG - Intronic
1117734665 14:58756434-58756456 CTGCCTCCAACCCTGCAGCTGGG - Intergenic
1118835531 14:69475375-69475397 CTGCCCACAGCGATGCCGGTGGG + Intergenic
1119652652 14:76394602-76394624 TTGGCTACAGTTCTGCAGCTTGG + Intronic
1124250641 15:28104657-28104679 CTGCCTGCAGCTGGGCAGGTGGG - Intergenic
1124911903 15:33929388-33929410 CTGTCTACAGCTATGCAGTGTGG - Intronic
1125601444 15:40917924-40917946 GTACCCACAGCTAGGCAGCTGGG - Intergenic
1128081467 15:64859696-64859718 CTGCCCACCAGTATGCAGCTGGG - Intronic
1128977857 15:72166619-72166641 CCACCTACAGGTATGGAGCTTGG - Exonic
1131538125 15:93254222-93254244 CTGTCAACAGCTGGGCAGCTGGG + Intergenic
1137764216 16:50965381-50965403 CAGCCTCCAGCCATGCTGCTGGG + Intergenic
1140820966 16:78662756-78662778 TTGCCAACAACTGTGCAGCTTGG - Intronic
1140935517 16:79666129-79666151 CTGCCTAAATCTATGCAAATTGG + Intergenic
1145835663 17:27952574-27952596 CTGCCTACTCCCATGCAGCCCGG + Intergenic
1147242660 17:39100788-39100810 CTGCCTGCAGCCATGGAGCCAGG + Intronic
1147479095 17:40741970-40741992 CTGCCAATACCTATGCAGCTGGG + Intergenic
1149085514 17:52710567-52710589 CTGCCTACAGAGAGGCAGGTGGG + Intergenic
1149085522 17:52710608-52710630 CTGCCTACAGAGAGGCAGGTGGG + Intergenic
1149085537 17:52710690-52710712 CTGCCTACAGAGAGGCAGCTGGG + Intergenic
1150512616 17:65773084-65773106 TTGTCTACGGCTATGCAGCCAGG + Intronic
1151542033 17:74769531-74769553 CTTCCTACAGGACTGCAGCTAGG - Intergenic
1152063474 17:78096522-78096544 CTGCAAACAGCTGTGCAGGTTGG + Intronic
1154466009 18:14643099-14643121 CTGCCTCCAGCAGTGCAGCCAGG - Intergenic
1155524027 18:26698268-26698290 TTGCCCACAGTCATGCAGCTAGG - Intergenic
1156823321 18:41399142-41399164 CTACCTACTGCTGTGCAGCCCGG - Intergenic
1157149927 18:45206473-45206495 CTGCCTAAAGGTATTCAGCGAGG + Intergenic
1161755650 19:6131589-6131611 CTGCCCCCAGCTCTGTAGCTGGG + Intronic
1164410789 19:28003172-28003194 CTGCCTACAGAAATGAAGCTTGG + Intergenic
1164515727 19:28933836-28933858 CTGCCTACAGAAATGAAGCCTGG + Intergenic
1164675344 19:30096948-30096970 TTTCCAACAGCTTTGCAGCTTGG - Intergenic
1165306010 19:35003437-35003459 CTGCCTTCAGCTATCCTGGTTGG + Intronic
1165403798 19:35618121-35618143 CTGCCTCCCGCTCTGCAGCCAGG - Exonic
1167034755 19:46988536-46988558 CTGCCAAGAGCTATGTAACTTGG - Intronic
926621453 2:15049954-15049976 CTGCCCTCGGCCATGCAGCTGGG + Intergenic
929957274 2:46467707-46467729 CTGCCCACAGTTACACAGCTAGG - Intronic
931894278 2:66712034-66712056 TTGCCTTCAGCTATGGAACTGGG + Intergenic
935423719 2:102897650-102897672 CTGTCTCCAGCTATGCTGTTAGG + Intergenic
943662401 2:190573173-190573195 TTGCCTGCAGCTATATAGCTAGG - Intergenic
944671689 2:201999501-201999523 CTGCCAGCAGCACTGCAGCTGGG - Intergenic
946154994 2:217801395-217801417 CTGCCACCAGCTGTCCAGCTGGG - Exonic
946373149 2:219292764-219292786 TTGCCTCCTGCTATGCGGCTCGG - Intronic
947161147 2:227215802-227215824 CTGCCTGCACCTATGATGCTAGG - Intronic
948334142 2:237194402-237194424 CTGCCCGTAGCTCTGCAGCTGGG - Intergenic
948385549 2:237578488-237578510 CAGCTTCCAGCGATGCAGCTGGG + Intronic
1169763222 20:9120081-9120103 GTGCCCACAGCTCTGCTGCTGGG - Intronic
1172791763 20:37510751-37510773 CTGCCTGCAGTTAGGGAGCTGGG - Intronic
1173648205 20:44646690-44646712 CTGCCTGCCGCTTAGCAGCTAGG - Intronic
1174130492 20:48340621-48340643 CTCCCTACAGCCACACAGCTTGG - Intergenic
1175301114 20:57943417-57943439 CAGCCTCCAGCTAGGCAGCCTGG + Intergenic
1176808577 21:13515497-13515519 CTGCCTCCAGCAGTGCAGCCAGG + Intergenic
1180844645 22:18974533-18974555 CTGCCTGCAGCCGTGGAGCTGGG + Intergenic
1181785394 22:25223140-25223162 CTGCCTACCCCTATTCAGGTGGG + Intronic
1181950684 22:26551463-26551485 CTGCCGAAGGCCATGCAGCTGGG + Intronic
951046479 3:18045056-18045078 CTGCCTGCTGCTTTTCAGCTAGG + Intronic
951543813 3:23806580-23806602 CTGCTCACAGCTATGCGGCCGGG - Intronic
952632379 3:35485051-35485073 CTGCATGCAGCTTTGCAACTTGG + Intergenic
952844474 3:37675457-37675479 CTGTCTCCAGCTCTGCATCTGGG + Intronic
953671649 3:44967872-44967894 CTGGCTACAGCAATGGAGATGGG + Intronic
956646731 3:71464298-71464320 CTGCCTACAGGTCTGCAAGTCGG + Intronic
957178725 3:76848593-76848615 CTGCTTACAGCTCTGGAGGTGGG + Intronic
960464566 3:117981058-117981080 GTGCTTCCAGCCATGCAGCTTGG + Intergenic
961246017 3:125454261-125454283 TTGCCTCCTGCTATGCAGCCTGG - Intronic
975056909 4:69944875-69944897 CTGCCTACCCCTATGCTGTTTGG + Exonic
975932813 4:79546168-79546190 CTGAATACAGCTATGAAACTTGG - Intergenic
984812191 4:183805300-183805322 ATGTCTACAGCTATGCAACAAGG - Intergenic
988463700 5:31466762-31466784 ATGGATACAGCTATGTAGCTTGG - Intronic
989479806 5:41917406-41917428 CTGCATAAAGATATCCAGCTTGG + Exonic
989730769 5:44645374-44645396 TAGCCCACAGCTATGCTGCTGGG - Intergenic
993391794 5:87327246-87327268 CTGCCTACATTTGCGCAGCTAGG + Intronic
997304991 5:132830368-132830390 CGCCCTGCAGCTCTGCAGCTGGG + Intronic
999481197 5:151949649-151949671 CTGCTTACAGTTATGAGGCTGGG - Intergenic
1001122412 5:168991555-168991577 CTGCCTACAGGTTTGCTGCTGGG - Intronic
1001595855 5:172898350-172898372 CTGCCCACAGCCATACAGTTAGG + Intronic
1001658949 5:173375982-173376004 TTGTCTAAAGGTATGCAGCTAGG - Intergenic
1001780649 5:174366127-174366149 GAGCCTGCAGCTATGCTGCTTGG - Intergenic
1002185189 5:177451216-177451238 GTGCCCACAGCAATGCAGCCAGG + Intronic
1002435593 5:179229011-179229033 CTACCTCCAGCTGTGCACCTCGG + Intronic
1003013766 6:2451540-2451562 CTGCCTGGAGCTGTACAGCTGGG - Intergenic
1003101337 6:3178654-3178676 TTGCCTATAGCTATGAAGCCTGG + Intergenic
1004375788 6:15089763-15089785 CTCCATACAGGTGTGCAGCTGGG - Intergenic
1005032366 6:21522994-21523016 CTGCGTGATGCTATGCAGCTAGG - Intergenic
1005157194 6:22820083-22820105 CTGCCAGCAGCCATGCAGCATGG - Intergenic
1005236852 6:23773725-23773747 CAGCCTAAAGTTGTGCAGCTTGG + Intergenic
1007238681 6:40409812-40409834 CTGCCTCCAGGCATGCAGCTTGG - Intronic
1012752881 6:103184951-103184973 CTGCACACAGCTAGGCACCTTGG - Intergenic
1019377112 7:698696-698718 GTGCGCACAGCTATGCATCTGGG + Intronic
1019789387 7:3000951-3000973 ATGCCTGCAGCAAGGCAGCTGGG + Intronic
1027359656 7:77394805-77394827 CTGCCTACACATGTACAGCTTGG - Intronic
1029226882 7:99034744-99034766 CTGCCTATAGATTTGCTGCTGGG - Intronic
1030995737 7:116356466-116356488 CTGCCACCAGCCATGCTGCTGGG + Intronic
1035340905 7:158160677-158160699 ATGCCTGCAGTTATACAGCTGGG + Intronic
1037503879 8:19511575-19511597 CTGCCTACAGGAATTCAACTGGG - Intronic
1041632711 8:60106047-60106069 CTTCCTACAGCATGGCAGCTGGG + Intergenic
1048970525 8:139642886-139642908 CTGCCAACAGCTATGCTTCCTGG - Intronic
1055646159 9:78363465-78363487 CTGCCAACAGCTACTGAGCTTGG - Intergenic
1055711088 9:79062744-79062766 CTGCCTAGAGCTACTCAGCTTGG - Intergenic
1057744885 9:97742932-97742954 CTGCTTACAGAGATGCAGCAAGG - Intergenic
1058087086 9:100759540-100759562 CTGCCTATTGCTATGCAACAAGG + Intergenic
1058886087 9:109322006-109322028 CAGCCAACAGCTTTGGAGCTGGG - Intergenic
1060758089 9:126227161-126227183 CTGCCTAAGGCAATGCAGCCAGG + Intergenic
1061643476 9:131979196-131979218 CTGCCTCCAGCTATGTGCCTCGG - Intronic
1062205181 9:135332550-135332572 CTGCCCCCAGCACTGCAGCTTGG - Intergenic
1186586163 X:10875388-10875410 CCACCTACAGCTTTCCAGCTTGG - Intergenic
1187245648 X:17550900-17550922 CTGCATAGAGCTGTGCAGATGGG - Intronic
1189082839 X:37992644-37992666 CTGCCTACAGGTCTGCTGTTAGG - Intronic
1189684460 X:43549532-43549554 CTGCCAACAGCCATGCATCTTGG + Intergenic
1190140060 X:47835321-47835343 TTGCCTAAAGCTTTGCACCTGGG - Intergenic
1195587892 X:106586664-106586686 CTTCCTACACCCATGAAGCTAGG + Intergenic
1198114625 X:133533355-133533377 CTGGCTTCAGCTATGTAGATGGG - Intergenic
1201262500 Y:12173975-12173997 CTGCATACAGCGAAGCAGGTTGG - Intergenic