ID: 1084303563

View in Genome Browser
Species Human (GRCh38)
Location 11:68266836-68266858
Sequence CCCGGGATTTGAGGTCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084303555_1084303563 -10 Left 1084303555 11:68266823-68266845 CCCCAGGCCCGAGCCCGGGATTT 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1084303563 11:68266836-68266858 CCCGGGATTTGAGGTCCTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 84
1084303552_1084303563 1 Left 1084303552 11:68266812-68266834 CCTGGTATGTTCCCCAGGCCCGA 0: 1
1: 0
2: 0
3: 6
4: 154
Right 1084303563 11:68266836-68266858 CCCGGGATTTGAGGTCCTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 84
1084303546_1084303563 27 Left 1084303546 11:68266786-68266808 CCGAATGTTTTTAAAATGCTACC 0: 1
1: 1
2: 0
3: 38
4: 346
Right 1084303563 11:68266836-68266858 CCCGGGATTTGAGGTCCTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 84
1084303548_1084303563 6 Left 1084303548 11:68266807-68266829 CCACCCCTGGTATGTTCCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 187
Right 1084303563 11:68266836-68266858 CCCGGGATTTGAGGTCCTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 84
1084303550_1084303563 3 Left 1084303550 11:68266810-68266832 CCCCTGGTATGTTCCCCAGGCCC 0: 1
1: 0
2: 0
3: 10
4: 195
Right 1084303563 11:68266836-68266858 CCCGGGATTTGAGGTCCTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 84
1084303551_1084303563 2 Left 1084303551 11:68266811-68266833 CCCTGGTATGTTCCCCAGGCCCG 0: 1
1: 0
2: 0
3: 28
4: 475
Right 1084303563 11:68266836-68266858 CCCGGGATTTGAGGTCCTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084303563 Original CRISPR CCCGGGATTTGAGGTCCTCT GGG Intronic