ID: 1084304375

View in Genome Browser
Species Human (GRCh38)
Location 11:68272001-68272023
Sequence TGACGTCACGGAGGGCGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 123}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084304360_1084304375 3 Left 1084304360 11:68271975-68271997 CCCGGGCCCCGCCCAAACGCCGG 0: 1
1: 0
2: 2
3: 18
4: 154
Right 1084304375 11:68272001-68272023 TGACGTCACGGAGGGCGGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 123
1084304363_1084304375 -3 Left 1084304363 11:68271981-68272003 CCCCGCCCAAACGCCGGAAATGA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1084304375 11:68272001-68272023 TGACGTCACGGAGGGCGGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 123
1084304366_1084304375 -8 Left 1084304366 11:68271986-68272008 CCCAAACGCCGGAAATGACGTCA 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1084304375 11:68272001-68272023 TGACGTCACGGAGGGCGGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 123
1084304354_1084304375 30 Left 1084304354 11:68271948-68271970 CCAGGCAGCTCCGGGCAGCGCGC 0: 1
1: 0
2: 0
3: 25
4: 244
Right 1084304375 11:68272001-68272023 TGACGTCACGGAGGGCGGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 123
1084304358_1084304375 8 Left 1084304358 11:68271970-68271992 CCCTGCCCGGGCCCCGCCCAAAC 0: 1
1: 0
2: 2
3: 26
4: 307
Right 1084304375 11:68272001-68272023 TGACGTCACGGAGGGCGGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 123
1084304356_1084304375 20 Left 1084304356 11:68271958-68271980 CCGGGCAGCGCGCCCTGCCCGGG 0: 1
1: 0
2: 1
3: 32
4: 364
Right 1084304375 11:68272001-68272023 TGACGTCACGGAGGGCGGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 123
1084304365_1084304375 -5 Left 1084304365 11:68271983-68272005 CCGCCCAAACGCCGGAAATGACG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1084304375 11:68272001-68272023 TGACGTCACGGAGGGCGGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 123
1084304359_1084304375 7 Left 1084304359 11:68271971-68271993 CCTGCCCGGGCCCCGCCCAAACG 0: 1
1: 0
2: 2
3: 22
4: 272
Right 1084304375 11:68272001-68272023 TGACGTCACGGAGGGCGGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 123
1084304367_1084304375 -9 Left 1084304367 11:68271987-68272009 CCAAACGCCGGAAATGACGTCAC 0: 1
1: 0
2: 0
3: 2
4: 17
Right 1084304375 11:68272001-68272023 TGACGTCACGGAGGGCGGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 123
1084304364_1084304375 -4 Left 1084304364 11:68271982-68272004 CCCGCCCAAACGCCGGAAATGAC 0: 1
1: 0
2: 1
3: 2
4: 37
Right 1084304375 11:68272001-68272023 TGACGTCACGGAGGGCGGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 123
1084304362_1084304375 2 Left 1084304362 11:68271976-68271998 CCGGGCCCCGCCCAAACGCCGGA 0: 1
1: 0
2: 3
3: 7
4: 112
Right 1084304375 11:68272001-68272023 TGACGTCACGGAGGGCGGGGCGG 0: 1
1: 0
2: 1
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084304375 Original CRISPR TGACGTCACGGAGGGCGGGG CGG Intronic
902690472 1:18107690-18107712 GGAGGGCAAGGAGGGCGGGGGGG + Intergenic
903285166 1:22272585-22272607 TGAAGCCACGGAGGACGGGGTGG + Intergenic
903330084 1:22592832-22592854 CGCCGTCAAGGAGGGAGGGGTGG + Intronic
903918378 1:26780924-26780946 TGAGGTGATGGAGGGAGGGGAGG - Exonic
910288498 1:85578851-85578873 TGAAGTGACGGGGGGCGGGAGGG - Intergenic
910781893 1:90947026-90947048 TGAAGGCAAGGAGGGCAGGGAGG + Intronic
915333846 1:155129394-155129416 CGGCGTCAGGGAAGGCGGGGAGG - Intronic
918045962 1:180941227-180941249 TGACGTCAGGCCAGGCGGGGCGG - Exonic
922757279 1:228103330-228103352 TGACGTCACGGCGCGCGACGCGG - Exonic
923506497 1:234609893-234609915 GGCCGGCACGGAGTGCGGGGCGG + Intergenic
1064418256 10:15168767-15168789 GGGCGGGACGGAGGGCGGGGAGG - Intergenic
1065701618 10:28431303-28431325 TGACGTCACACAGGGAGGTGAGG - Intergenic
1070318090 10:75333642-75333664 TGCCGTCCCGGAGGGAGGTGGGG - Intergenic
1070717151 10:78731022-78731044 TGACATCACACAGGGCAGGGTGG + Intergenic
1073131066 10:101189640-101189662 TGAGGTCAAGGAAGGCGAGGTGG - Intergenic
1075647776 10:124107883-124107905 TGATGGCAAGGAAGGCGGGGGGG - Intergenic
1076779661 10:132717247-132717269 TGAGGTCACGGGGGTGGGGGAGG - Intronic
1082645718 11:55721786-55721808 TGACGTCAGGCCGGGCGCGGTGG - Intergenic
1083285237 11:61654556-61654578 TGATGTCGGGGAGGGAGGGGAGG - Intergenic
1083441411 11:62678961-62678983 TGACGAGAAGGAGGGCGGGAAGG + Exonic
1084108491 11:66997190-66997212 TGAGGTCAGGCAGGGCGTGGTGG + Intergenic
1084151345 11:67289296-67289318 GGGCGGCAGGGAGGGCGGGGCGG - Exonic
1084304375 11:68272001-68272023 TGACGTCACGGAGGGCGGGGCGG + Intronic
1088606774 11:111540661-111540683 TGACGTCCCAGGGGGCGGAGGGG + Exonic
1089556221 11:119317155-119317177 TGACGTCAGGGGGGCGGGGGAGG + Intronic
1090517658 11:127446165-127446187 AGACGTCACGTAGGGGGCGGTGG + Intergenic
1091792902 12:3281609-3281631 TGAGGCCAGGGAGGGCTGGGAGG + Intronic
1096233887 12:49912892-49912914 TGAGCTCCTGGAGGGCGGGGAGG - Intergenic
1102025449 12:109712109-109712131 GGACGTCAGGGAGGGCGGCCGGG - Intergenic
1103901900 12:124307656-124307678 TGCCTTCACGGAGGGCTGGGCGG + Intronic
1104402270 12:128485817-128485839 TGAGCTGACGGAGGGCGCGGAGG + Intronic
1113566098 13:111320592-111320614 TGATGTCACAGCGGGCGGGGTGG + Intronic
1114324607 14:21575955-21575977 TGAAGTCAAGGAACGCGGGGAGG - Intergenic
1116887058 14:50231720-50231742 TGTCGGCTGGGAGGGCGGGGAGG - Intergenic
1119996272 14:79257158-79257180 TGAAGGCAGGGAGGGCGAGGGGG + Intronic
1120429718 14:84399471-84399493 GGAGCCCACGGAGGGCGGGGAGG + Intergenic
1125674759 15:41495973-41495995 CGACGGCTCGGAGGGCGGCGGGG - Intronic
1126172382 15:45705140-45705162 TGCCGTAGCGGGGGGCGGGGGGG - Intergenic
1130402674 15:83572047-83572069 TGACATCAGAGAGGGCAGGGAGG + Intronic
1132378804 15:101351129-101351151 TGACGTCACTGAAGACGGGTTGG - Intronic
1132812763 16:1809488-1809510 AGAGGACACGGAGGGCGGGGAGG + Intronic
1132828888 16:1918120-1918142 GGACGGCTCGGAGGGCGCGGGGG + Exonic
1133147826 16:3803254-3803276 TGACGGCGGGGAGGGGGGGGGGG + Intronic
1133259500 16:4538817-4538839 GGACGTCACGGTGGGGGGTGGGG + Intronic
1134291213 16:12903634-12903656 TGAGGTCCGGGCGGGCGGGGTGG + Intronic
1136044038 16:27601675-27601697 TGAGGTCAAGGAGGGTGGCGAGG + Intronic
1138498513 16:57423514-57423536 TGAAGTCACTGAGGGCTGAGTGG + Intergenic
1145884160 17:28371358-28371380 CGATGTCACGTGGGGCGGGGAGG + Intronic
1149568144 17:57653749-57653771 TGAAGTCAAGGAGAACGGGGTGG - Intronic
1151347087 17:73508780-73508802 TGGCTTCACGGAGGGAGGTGTGG - Intronic
1152360715 17:79832013-79832035 TGAGGGCCAGGAGGGCGGGGAGG - Intergenic
1152454157 17:80403342-80403364 TGAAGTAACGGGGGGGGGGGGGG - Intergenic
1154171577 18:12056678-12056700 TGACCTCAAGGAGAGTGGGGCGG - Intergenic
1157770421 18:50340350-50340372 TGTCCTCACGGAAGGCAGGGAGG + Intergenic
1159887437 18:73922673-73922695 TGATGTCACGGATAGCAGGGTGG + Intergenic
1160453590 18:78980637-78980659 GGACGGCTCGGAGGCCGGGGCGG + Intronic
1163156492 19:15442634-15442656 TGACCTCAGGGAGGGCAGGGGGG - Intronic
1165445140 19:35852633-35852655 TGGGGTCACGGAGGCTGGGGAGG - Intronic
1165732550 19:38155616-38155638 TGACGTCAGAGTGGGAGGGGTGG + Intronic
1167312820 19:48746977-48746999 TGACGTCATGGAGCGATGGGCGG - Intergenic
1167333755 19:48872348-48872370 TGACGTCACGAAGAGAGGCGGGG - Intergenic
1167621829 19:50565027-50565049 TGACCTCTCGGACGGCGAGGAGG + Intronic
1168063841 19:53908582-53908604 TGACATCACGGCGGGGGGGGGGG + Intergenic
1168680665 19:58313090-58313112 TGACGTCACTGAGGTAAGGGCGG - Intronic
925387565 2:3472819-3472841 TGACTTCACGGAGGACAGGTGGG + Intronic
926174888 2:10581951-10581973 TGACCTCAGGGAGGGAGGTGGGG + Intronic
927956677 2:27211990-27212012 TGGCGGCACGGCGAGCGGGGCGG - Intronic
929552641 2:42904273-42904295 TGAGGTCACGGAGAGCCAGGGGG + Intergenic
946111772 2:217426102-217426124 TGATGTCATGGAGGACTGGGAGG - Intronic
947748755 2:232522390-232522412 TGGGGGCACGGAGGGCGGGCCGG - Intronic
947794632 2:232886497-232886519 TGTCGGCAGGGAGGGCGAGGTGG + Intronic
1172114056 20:32563249-32563271 GGAGGTCAGGGAGGGTGGGGAGG + Intronic
1175198158 20:57260392-57260414 TGACGTCACCAGGAGCGGGGAGG - Intronic
1175562279 20:59940340-59940362 CGGCGTCACGAGGGGCGGGGCGG - Intronic
1176084022 20:63287786-63287808 CGACGGCGGGGAGGGCGGGGAGG + Exonic
1179881417 21:44294735-44294757 TGACGTCACGGTTGGCTGTGTGG + Intronic
1181771534 22:25129150-25129172 TGGCGGCATGGTGGGCGGGGCGG + Intronic
1182124151 22:27804258-27804280 TGACTTCACACAGGGCTGGGTGG + Intergenic
1183984260 22:41560965-41560987 TGACGTCAGGGAGAGCAGGAGGG - Exonic
1184349817 22:43936232-43936254 TGACATCTCGGAGGGTGAGGAGG + Intronic
1185261210 22:49864939-49864961 TGACTTCACGGGGGGGGGGGGGG - Intronic
1185337827 22:50278629-50278651 TGACGTCACAGCGGGAGGGCCGG - Exonic
950674230 3:14544948-14544970 TGACTTCAGGGAAGGCTGGGAGG + Intergenic
954128026 3:48543615-48543637 GGACGTCACGGAGGGCTGCCAGG + Exonic
954840794 3:53509600-53509622 TGACCCGAGGGAGGGCGGGGAGG + Intronic
955394858 3:58550188-58550210 TGACGTCTGGGAGGGAGGTGTGG - Intergenic
967093782 3:186159839-186159861 TGAGGTCACAAGGGGCGGGGGGG + Intronic
969728579 4:8940023-8940045 GGGCGTCAGGGAGGGTGGGGTGG + Intergenic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
977719018 4:100217149-100217171 TGGCGGCACTGGGGGCGGGGAGG - Intergenic
979523899 4:121697318-121697340 TGCGGTCACAGAGGGCAGGGAGG - Intergenic
979715480 4:123832344-123832366 TGACATGACGGGGGGCGGAGGGG + Intergenic
985548619 5:522230-522252 AGACGTCCTTGAGGGCGGGGAGG - Intronic
996035132 5:118750364-118750386 GGAGGTCATGGAGGTCGGGGAGG + Intergenic
1001397259 5:171426293-171426315 TGTCGTCACTGTGGGAGGGGAGG + Intronic
1001840909 5:174875922-174875944 TGAGGTCACGGGGGCTGGGGTGG + Intergenic
1006132821 6:31879035-31879057 TGACGTGTGGGAGGGCGGGGCGG - Intronic
1007813043 6:44499790-44499812 TGACGTTATGGAGGGTAGGGAGG + Intergenic
1010871146 6:81041981-81042003 TGAGGATACGGAGGGCAGGGAGG + Intergenic
1012551346 6:100466973-100466995 TGACGTCCTGGGGGGCTGGGCGG + Intergenic
1014164209 6:118205114-118205136 TGACTTGACGGAGGATGGGGAGG - Intronic
1014802241 6:125790565-125790587 GGAGGTCGCGGGGGGCGGGGAGG + Intronic
1017002719 6:150006980-150007002 TGACTTCAGGGAGGGCGGCAGGG - Intergenic
1019153571 6:170024287-170024309 TGACGTCACAGGGCTCGGGGTGG - Intergenic
1019738192 7:2660635-2660657 GGACGCCACGGAGGGGGTGGGGG - Intronic
1021477208 7:21075634-21075656 TGACATCTCTGAGGGTGGGGAGG + Intergenic
1024236176 7:47400869-47400891 TGACGTCACGGGTGGCCGAGCGG + Exonic
1028604625 7:92642396-92642418 TGAGGTCACAGTGGGCTGGGCGG - Intronic
1029496276 7:100896819-100896841 TGAACTCCTGGAGGGCGGGGCGG - Intronic
1029547229 7:101216923-101216945 TGACCCCAAGGAGGGCAGGGTGG + Intronic
1030121115 7:106111985-106112007 GGACGGCAGGGAGGGCAGGGAGG - Intronic
1030191204 7:106812100-106812122 AGACCTCACTGAGGCCGGGGAGG - Intergenic
1037450708 8:19013768-19013790 TGACGTTACTGGGGGCCGGGCGG - Intronic
1042274211 8:66986225-66986247 TGATGTCAGGCAGGGCGCGGTGG - Intronic
1043372597 8:79611866-79611888 GGAAGTCGCGGAGGGCGTGGAGG + Intronic
1044051186 8:87506989-87507011 TGATGTCATGGAGGGGGAGGAGG - Intronic
1044792793 8:95864941-95864963 TGACCACACAGAGGGTGGGGTGG + Intergenic
1046573274 8:115993326-115993348 AGAAGTCACAGAAGGCGGGGTGG + Intergenic
1048443797 8:134478565-134478587 TGTCTACACGCAGGGCGGGGAGG - Exonic
1048863200 8:138739189-138739211 TGAGGTCATGGAGGGCAGGCTGG - Intronic
1049906626 9:223467-223489 TGAAGTCACGGAGGGCTATGAGG - Intronic
1051287391 9:15510770-15510792 CGACGCCACCGAGGGGGGGGCGG + Intronic
1056551574 9:87657434-87657456 TGATGTCATGGAAGGCAGGGTGG + Intronic
1057313598 9:93955767-93955789 TGACGTGACGGAGGGCACAGAGG + Intergenic
1062119830 9:134828215-134828237 TGACGCCACGGATGGATGGGTGG - Intronic
1062681603 9:137784985-137785007 TGAGGTCAGGGAGTGGGGGGTGG + Intronic
1062731522 9:138112823-138112845 AGACGTGAGGGAGCGCGGGGAGG + Intronic
1189381697 X:40506846-40506868 TGACTTCATGGAGGGGGTGGAGG + Intergenic
1189763234 X:44343694-44343716 CGGCGTCACGGAGGGAGGAGGGG + Intergenic
1190217479 X:48489485-48489507 TGAGGTCAAGGAGGGCCCGGAGG + Intergenic
1190232152 X:48590499-48590521 TGAGGTCAGGGAGGGCCCGGAGG + Intronic
1195909580 X:109875978-109876000 GGAGCCCACGGAGGGCGGGGAGG + Intergenic
1196932532 X:120695909-120695931 TGAGCTCCCGGAGGGAGGGGCGG + Intergenic