ID: 1084307877

View in Genome Browser
Species Human (GRCh38)
Location 11:68298626-68298648
Sequence ACTGTGCCAGCAGGATAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084307877_1084307887 21 Left 1084307877 11:68298626-68298648 CCCAGCTATCCTGCTGGCACAGT No data
Right 1084307887 11:68298670-68298692 CCCACTCCTGCTAGAGCCTAGGG No data
1084307877_1084307889 22 Left 1084307877 11:68298626-68298648 CCCAGCTATCCTGCTGGCACAGT No data
Right 1084307889 11:68298671-68298693 CCACTCCTGCTAGAGCCTAGGGG No data
1084307877_1084307885 20 Left 1084307877 11:68298626-68298648 CCCAGCTATCCTGCTGGCACAGT No data
Right 1084307885 11:68298669-68298691 ACCCACTCCTGCTAGAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084307877 Original CRISPR ACTGTGCCAGCAGGATAGCT GGG (reversed) Intergenic