ID: 1084307878

View in Genome Browser
Species Human (GRCh38)
Location 11:68298627-68298649
Sequence TACTGTGCCAGCAGGATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084307878_1084307885 19 Left 1084307878 11:68298627-68298649 CCAGCTATCCTGCTGGCACAGTA No data
Right 1084307885 11:68298669-68298691 ACCCACTCCTGCTAGAGCCTAGG No data
1084307878_1084307889 21 Left 1084307878 11:68298627-68298649 CCAGCTATCCTGCTGGCACAGTA No data
Right 1084307889 11:68298671-68298693 CCACTCCTGCTAGAGCCTAGGGG No data
1084307878_1084307887 20 Left 1084307878 11:68298627-68298649 CCAGCTATCCTGCTGGCACAGTA No data
Right 1084307887 11:68298670-68298692 CCCACTCCTGCTAGAGCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084307878 Original CRISPR TACTGTGCCAGCAGGATAGC TGG (reversed) Intergenic