ID: 1084307880

View in Genome Browser
Species Human (GRCh38)
Location 11:68298635-68298657
Sequence TGGCTTCCTACTGTGCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084307880_1084307887 12 Left 1084307880 11:68298635-68298657 CCTGCTGGCACAGTAGGAAGCCA No data
Right 1084307887 11:68298670-68298692 CCCACTCCTGCTAGAGCCTAGGG No data
1084307880_1084307892 30 Left 1084307880 11:68298635-68298657 CCTGCTGGCACAGTAGGAAGCCA No data
Right 1084307892 11:68298688-68298710 TAGGGGCTGCTGTTCCCTCTAGG No data
1084307880_1084307885 11 Left 1084307880 11:68298635-68298657 CCTGCTGGCACAGTAGGAAGCCA No data
Right 1084307885 11:68298669-68298691 ACCCACTCCTGCTAGAGCCTAGG No data
1084307880_1084307889 13 Left 1084307880 11:68298635-68298657 CCTGCTGGCACAGTAGGAAGCCA No data
Right 1084307889 11:68298671-68298693 CCACTCCTGCTAGAGCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084307880 Original CRISPR TGGCTTCCTACTGTGCCAGC AGG (reversed) Intergenic