ID: 1084307881

View in Genome Browser
Species Human (GRCh38)
Location 11:68298655-68298677
Sequence GGAGTGGGTAGGGGCTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084307881_1084307893 21 Left 1084307881 11:68298655-68298677 CCAGAAAAGCCCCTACCCACTCC No data
Right 1084307893 11:68298699-68298721 GTTCCCTCTAGGACTCCACCAGG No data
1084307881_1084307897 28 Left 1084307881 11:68298655-68298677 CCAGAAAAGCCCCTACCCACTCC No data
Right 1084307897 11:68298706-68298728 CTAGGACTCCACCAGGGAGCAGG No data
1084307881_1084307892 10 Left 1084307881 11:68298655-68298677 CCAGAAAAGCCCCTACCCACTCC No data
Right 1084307892 11:68298688-68298710 TAGGGGCTGCTGTTCCCTCTAGG No data
1084307881_1084307887 -8 Left 1084307881 11:68298655-68298677 CCAGAAAAGCCCCTACCCACTCC No data
Right 1084307887 11:68298670-68298692 CCCACTCCTGCTAGAGCCTAGGG No data
1084307881_1084307885 -9 Left 1084307881 11:68298655-68298677 CCAGAAAAGCCCCTACCCACTCC No data
Right 1084307885 11:68298669-68298691 ACCCACTCCTGCTAGAGCCTAGG No data
1084307881_1084307889 -7 Left 1084307881 11:68298655-68298677 CCAGAAAAGCCCCTACCCACTCC No data
Right 1084307889 11:68298671-68298693 CCACTCCTGCTAGAGCCTAGGGG No data
1084307881_1084307894 22 Left 1084307881 11:68298655-68298677 CCAGAAAAGCCCCTACCCACTCC No data
Right 1084307894 11:68298700-68298722 TTCCCTCTAGGACTCCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084307881 Original CRISPR GGAGTGGGTAGGGGCTTTTC TGG (reversed) Intergenic
No off target data available for this crispr