ID: 1084307882

View in Genome Browser
Species Human (GRCh38)
Location 11:68298664-68298686
Sequence GCTCTAGCAGGAGTGGGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084307882_1084307892 1 Left 1084307882 11:68298664-68298686 CCCCTACCCACTCCTGCTAGAGC No data
Right 1084307892 11:68298688-68298710 TAGGGGCTGCTGTTCCCTCTAGG No data
1084307882_1084307898 22 Left 1084307882 11:68298664-68298686 CCCCTACCCACTCCTGCTAGAGC No data
Right 1084307898 11:68298709-68298731 GGACTCCACCAGGGAGCAGGAGG No data
1084307882_1084307900 24 Left 1084307882 11:68298664-68298686 CCCCTACCCACTCCTGCTAGAGC No data
Right 1084307900 11:68298711-68298733 ACTCCACCAGGGAGCAGGAGGGG No data
1084307882_1084307894 13 Left 1084307882 11:68298664-68298686 CCCCTACCCACTCCTGCTAGAGC No data
Right 1084307894 11:68298700-68298722 TTCCCTCTAGGACTCCACCAGGG No data
1084307882_1084307899 23 Left 1084307882 11:68298664-68298686 CCCCTACCCACTCCTGCTAGAGC No data
Right 1084307899 11:68298710-68298732 GACTCCACCAGGGAGCAGGAGGG No data
1084307882_1084307893 12 Left 1084307882 11:68298664-68298686 CCCCTACCCACTCCTGCTAGAGC No data
Right 1084307893 11:68298699-68298721 GTTCCCTCTAGGACTCCACCAGG No data
1084307882_1084307897 19 Left 1084307882 11:68298664-68298686 CCCCTACCCACTCCTGCTAGAGC No data
Right 1084307897 11:68298706-68298728 CTAGGACTCCACCAGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084307882 Original CRISPR GCTCTAGCAGGAGTGGGTAG GGG (reversed) Intergenic