ID: 1084307884

View in Genome Browser
Species Human (GRCh38)
Location 11:68298666-68298688
Sequence AGGCTCTAGCAGGAGTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084307884_1084307899 21 Left 1084307884 11:68298666-68298688 CCTACCCACTCCTGCTAGAGCCT No data
Right 1084307899 11:68298710-68298732 GACTCCACCAGGGAGCAGGAGGG No data
1084307884_1084307898 20 Left 1084307884 11:68298666-68298688 CCTACCCACTCCTGCTAGAGCCT No data
Right 1084307898 11:68298709-68298731 GGACTCCACCAGGGAGCAGGAGG No data
1084307884_1084307894 11 Left 1084307884 11:68298666-68298688 CCTACCCACTCCTGCTAGAGCCT No data
Right 1084307894 11:68298700-68298722 TTCCCTCTAGGACTCCACCAGGG No data
1084307884_1084307892 -1 Left 1084307884 11:68298666-68298688 CCTACCCACTCCTGCTAGAGCCT No data
Right 1084307892 11:68298688-68298710 TAGGGGCTGCTGTTCCCTCTAGG No data
1084307884_1084307893 10 Left 1084307884 11:68298666-68298688 CCTACCCACTCCTGCTAGAGCCT No data
Right 1084307893 11:68298699-68298721 GTTCCCTCTAGGACTCCACCAGG No data
1084307884_1084307897 17 Left 1084307884 11:68298666-68298688 CCTACCCACTCCTGCTAGAGCCT No data
Right 1084307897 11:68298706-68298728 CTAGGACTCCACCAGGGAGCAGG No data
1084307884_1084307900 22 Left 1084307884 11:68298666-68298688 CCTACCCACTCCTGCTAGAGCCT No data
Right 1084307900 11:68298711-68298733 ACTCCACCAGGGAGCAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084307884 Original CRISPR AGGCTCTAGCAGGAGTGGGT AGG (reversed) Intergenic
No off target data available for this crispr