ID: 1084307889

View in Genome Browser
Species Human (GRCh38)
Location 11:68298671-68298693
Sequence CCACTCCTGCTAGAGCCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084307877_1084307889 22 Left 1084307877 11:68298626-68298648 CCCAGCTATCCTGCTGGCACAGT No data
Right 1084307889 11:68298671-68298693 CCACTCCTGCTAGAGCCTAGGGG No data
1084307880_1084307889 13 Left 1084307880 11:68298635-68298657 CCTGCTGGCACAGTAGGAAGCCA No data
Right 1084307889 11:68298671-68298693 CCACTCCTGCTAGAGCCTAGGGG No data
1084307878_1084307889 21 Left 1084307878 11:68298627-68298649 CCAGCTATCCTGCTGGCACAGTA No data
Right 1084307889 11:68298671-68298693 CCACTCCTGCTAGAGCCTAGGGG No data
1084307881_1084307889 -7 Left 1084307881 11:68298655-68298677 CCAGAAAAGCCCCTACCCACTCC No data
Right 1084307889 11:68298671-68298693 CCACTCCTGCTAGAGCCTAGGGG No data
1084307876_1084307889 27 Left 1084307876 11:68298621-68298643 CCAGGCCCAGCTATCCTGCTGGC No data
Right 1084307889 11:68298671-68298693 CCACTCCTGCTAGAGCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084307889 Original CRISPR CCACTCCTGCTAGAGCCTAG GGG Intergenic