ID: 1084307890

View in Genome Browser
Species Human (GRCh38)
Location 11:68298676-68298698
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084307890_1084307900 12 Left 1084307890 11:68298676-68298698 CCTGCTAGAGCCTAGGGGCTGCT No data
Right 1084307900 11:68298711-68298733 ACTCCACCAGGGAGCAGGAGGGG No data
1084307890_1084307906 27 Left 1084307890 11:68298676-68298698 CCTGCTAGAGCCTAGGGGCTGCT No data
Right 1084307906 11:68298726-68298748 AGGAGGGGCCTTCACGGGGCTGG No data
1084307890_1084307905 23 Left 1084307890 11:68298676-68298698 CCTGCTAGAGCCTAGGGGCTGCT No data
Right 1084307905 11:68298722-68298744 GAGCAGGAGGGGCCTTCACGGGG No data
1084307890_1084307893 0 Left 1084307890 11:68298676-68298698 CCTGCTAGAGCCTAGGGGCTGCT No data
Right 1084307893 11:68298699-68298721 GTTCCCTCTAGGACTCCACCAGG No data
1084307890_1084307903 21 Left 1084307890 11:68298676-68298698 CCTGCTAGAGCCTAGGGGCTGCT No data
Right 1084307903 11:68298720-68298742 GGGAGCAGGAGGGGCCTTCACGG No data
1084307890_1084307904 22 Left 1084307890 11:68298676-68298698 CCTGCTAGAGCCTAGGGGCTGCT No data
Right 1084307904 11:68298721-68298743 GGAGCAGGAGGGGCCTTCACGGG No data
1084307890_1084307894 1 Left 1084307890 11:68298676-68298698 CCTGCTAGAGCCTAGGGGCTGCT No data
Right 1084307894 11:68298700-68298722 TTCCCTCTAGGACTCCACCAGGG No data
1084307890_1084307899 11 Left 1084307890 11:68298676-68298698 CCTGCTAGAGCCTAGGGGCTGCT No data
Right 1084307899 11:68298710-68298732 GACTCCACCAGGGAGCAGGAGGG No data
1084307890_1084307897 7 Left 1084307890 11:68298676-68298698 CCTGCTAGAGCCTAGGGGCTGCT No data
Right 1084307897 11:68298706-68298728 CTAGGACTCCACCAGGGAGCAGG No data
1084307890_1084307898 10 Left 1084307890 11:68298676-68298698 CCTGCTAGAGCCTAGGGGCTGCT No data
Right 1084307898 11:68298709-68298731 GGACTCCACCAGGGAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084307890 Original CRISPR AGCAGCCCCTAGGCTCTAGC AGG (reversed) Intergenic