ID: 1084307892

View in Genome Browser
Species Human (GRCh38)
Location 11:68298688-68298710
Sequence TAGGGGCTGCTGTTCCCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084307883_1084307892 0 Left 1084307883 11:68298665-68298687 CCCTACCCACTCCTGCTAGAGCC No data
Right 1084307892 11:68298688-68298710 TAGGGGCTGCTGTTCCCTCTAGG No data
1084307884_1084307892 -1 Left 1084307884 11:68298666-68298688 CCTACCCACTCCTGCTAGAGCCT No data
Right 1084307892 11:68298688-68298710 TAGGGGCTGCTGTTCCCTCTAGG No data
1084307888_1084307892 -6 Left 1084307888 11:68298671-68298693 CCACTCCTGCTAGAGCCTAGGGG No data
Right 1084307892 11:68298688-68298710 TAGGGGCTGCTGTTCCCTCTAGG No data
1084307881_1084307892 10 Left 1084307881 11:68298655-68298677 CCAGAAAAGCCCCTACCCACTCC No data
Right 1084307892 11:68298688-68298710 TAGGGGCTGCTGTTCCCTCTAGG No data
1084307882_1084307892 1 Left 1084307882 11:68298664-68298686 CCCCTACCCACTCCTGCTAGAGC No data
Right 1084307892 11:68298688-68298710 TAGGGGCTGCTGTTCCCTCTAGG No data
1084307886_1084307892 -5 Left 1084307886 11:68298670-68298692 CCCACTCCTGCTAGAGCCTAGGG No data
Right 1084307892 11:68298688-68298710 TAGGGGCTGCTGTTCCCTCTAGG No data
1084307880_1084307892 30 Left 1084307880 11:68298635-68298657 CCTGCTGGCACAGTAGGAAGCCA No data
Right 1084307892 11:68298688-68298710 TAGGGGCTGCTGTTCCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084307892 Original CRISPR TAGGGGCTGCTGTTCCCTCT AGG Intergenic
No off target data available for this crispr