ID: 1084307895

View in Genome Browser
Species Human (GRCh38)
Location 11:68298702-68298724
Sequence CTCCCTGGTGGAGTCCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084307895_1084307905 -3 Left 1084307895 11:68298702-68298724 CCCTCTAGGACTCCACCAGGGAG No data
Right 1084307905 11:68298722-68298744 GAGCAGGAGGGGCCTTCACGGGG No data
1084307895_1084307906 1 Left 1084307895 11:68298702-68298724 CCCTCTAGGACTCCACCAGGGAG No data
Right 1084307906 11:68298726-68298748 AGGAGGGGCCTTCACGGGGCTGG No data
1084307895_1084307904 -4 Left 1084307895 11:68298702-68298724 CCCTCTAGGACTCCACCAGGGAG No data
Right 1084307904 11:68298721-68298743 GGAGCAGGAGGGGCCTTCACGGG No data
1084307895_1084307903 -5 Left 1084307895 11:68298702-68298724 CCCTCTAGGACTCCACCAGGGAG No data
Right 1084307903 11:68298720-68298742 GGGAGCAGGAGGGGCCTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084307895 Original CRISPR CTCCCTGGTGGAGTCCTAGA GGG (reversed) Intergenic
No off target data available for this crispr