ID: 1084307896

View in Genome Browser
Species Human (GRCh38)
Location 11:68298703-68298725
Sequence GCTCCCTGGTGGAGTCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084307896_1084307905 -4 Left 1084307896 11:68298703-68298725 CCTCTAGGACTCCACCAGGGAGC No data
Right 1084307905 11:68298722-68298744 GAGCAGGAGGGGCCTTCACGGGG No data
1084307896_1084307903 -6 Left 1084307896 11:68298703-68298725 CCTCTAGGACTCCACCAGGGAGC No data
Right 1084307903 11:68298720-68298742 GGGAGCAGGAGGGGCCTTCACGG No data
1084307896_1084307904 -5 Left 1084307896 11:68298703-68298725 CCTCTAGGACTCCACCAGGGAGC No data
Right 1084307904 11:68298721-68298743 GGAGCAGGAGGGGCCTTCACGGG No data
1084307896_1084307906 0 Left 1084307896 11:68298703-68298725 CCTCTAGGACTCCACCAGGGAGC No data
Right 1084307906 11:68298726-68298748 AGGAGGGGCCTTCACGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084307896 Original CRISPR GCTCCCTGGTGGAGTCCTAG AGG (reversed) Intergenic