ID: 1084307904

View in Genome Browser
Species Human (GRCh38)
Location 11:68298721-68298743
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084307886_1084307904 28 Left 1084307886 11:68298670-68298692 CCCACTCCTGCTAGAGCCTAGGG No data
Right 1084307904 11:68298721-68298743 GGAGCAGGAGGGGCCTTCACGGG No data
1084307890_1084307904 22 Left 1084307890 11:68298676-68298698 CCTGCTAGAGCCTAGGGGCTGCT No data
Right 1084307904 11:68298721-68298743 GGAGCAGGAGGGGCCTTCACGGG No data
1084307896_1084307904 -5 Left 1084307896 11:68298703-68298725 CCTCTAGGACTCCACCAGGGAGC No data
Right 1084307904 11:68298721-68298743 GGAGCAGGAGGGGCCTTCACGGG No data
1084307888_1084307904 27 Left 1084307888 11:68298671-68298693 CCACTCCTGCTAGAGCCTAGGGG No data
Right 1084307904 11:68298721-68298743 GGAGCAGGAGGGGCCTTCACGGG No data
1084307891_1084307904 12 Left 1084307891 11:68298686-68298708 CCTAGGGGCTGCTGTTCCCTCTA No data
Right 1084307904 11:68298721-68298743 GGAGCAGGAGGGGCCTTCACGGG No data
1084307895_1084307904 -4 Left 1084307895 11:68298702-68298724 CCCTCTAGGACTCCACCAGGGAG No data
Right 1084307904 11:68298721-68298743 GGAGCAGGAGGGGCCTTCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084307904 Original CRISPR GGAGCAGGAGGGGCCTTCAC GGG Intergenic