ID: 1084307906

View in Genome Browser
Species Human (GRCh38)
Location 11:68298726-68298748
Sequence AGGAGGGGCCTTCACGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084307896_1084307906 0 Left 1084307896 11:68298703-68298725 CCTCTAGGACTCCACCAGGGAGC No data
Right 1084307906 11:68298726-68298748 AGGAGGGGCCTTCACGGGGCTGG No data
1084307895_1084307906 1 Left 1084307895 11:68298702-68298724 CCCTCTAGGACTCCACCAGGGAG No data
Right 1084307906 11:68298726-68298748 AGGAGGGGCCTTCACGGGGCTGG No data
1084307890_1084307906 27 Left 1084307890 11:68298676-68298698 CCTGCTAGAGCCTAGGGGCTGCT No data
Right 1084307906 11:68298726-68298748 AGGAGGGGCCTTCACGGGGCTGG No data
1084307891_1084307906 17 Left 1084307891 11:68298686-68298708 CCTAGGGGCTGCTGTTCCCTCTA No data
Right 1084307906 11:68298726-68298748 AGGAGGGGCCTTCACGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084307906 Original CRISPR AGGAGGGGCCTTCACGGGGC TGG Intergenic
No off target data available for this crispr