ID: 1084309445

View in Genome Browser
Species Human (GRCh38)
Location 11:68308214-68308236
Sequence CTGTGGTCAGAGGCGCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084309445_1084309450 -6 Left 1084309445 11:68308214-68308236 CCCAGGGGCGCCTCTGACCACAG No data
Right 1084309450 11:68308231-68308253 CCACAGCAGTCAGTCCTGCCGGG No data
1084309445_1084309454 1 Left 1084309445 11:68308214-68308236 CCCAGGGGCGCCTCTGACCACAG No data
Right 1084309454 11:68308238-68308260 AGTCAGTCCTGCCGGGTTGGGGG No data
1084309445_1084309457 4 Left 1084309445 11:68308214-68308236 CCCAGGGGCGCCTCTGACCACAG No data
Right 1084309457 11:68308241-68308263 CAGTCCTGCCGGGTTGGGGGGGG No data
1084309445_1084309448 -7 Left 1084309445 11:68308214-68308236 CCCAGGGGCGCCTCTGACCACAG No data
Right 1084309448 11:68308230-68308252 ACCACAGCAGTCAGTCCTGCCGG No data
1084309445_1084309453 0 Left 1084309445 11:68308214-68308236 CCCAGGGGCGCCTCTGACCACAG No data
Right 1084309453 11:68308237-68308259 CAGTCAGTCCTGCCGGGTTGGGG No data
1084309445_1084309456 3 Left 1084309445 11:68308214-68308236 CCCAGGGGCGCCTCTGACCACAG No data
Right 1084309456 11:68308240-68308262 TCAGTCCTGCCGGGTTGGGGGGG No data
1084309445_1084309451 -2 Left 1084309445 11:68308214-68308236 CCCAGGGGCGCCTCTGACCACAG No data
Right 1084309451 11:68308235-68308257 AGCAGTCAGTCCTGCCGGGTTGG No data
1084309445_1084309455 2 Left 1084309445 11:68308214-68308236 CCCAGGGGCGCCTCTGACCACAG No data
Right 1084309455 11:68308239-68308261 GTCAGTCCTGCCGGGTTGGGGGG No data
1084309445_1084309452 -1 Left 1084309445 11:68308214-68308236 CCCAGGGGCGCCTCTGACCACAG No data
Right 1084309452 11:68308236-68308258 GCAGTCAGTCCTGCCGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084309445 Original CRISPR CTGTGGTCAGAGGCGCCCCT GGG (reversed) Intergenic
No off target data available for this crispr