ID: 1084311634

View in Genome Browser
Species Human (GRCh38)
Location 11:68319760-68319782
Sequence ATGCTTTGTAATAGCAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084311634_1084311635 20 Left 1084311634 11:68319760-68319782 CCTTCATTGCTATTACAAAGCAT 0: 1
1: 0
2: 2
3: 12
4: 218
Right 1084311635 11:68319803-68319825 ATGTGTATAAGTGTTTTTATAGG 0: 2
1: 0
2: 5
3: 53
4: 654

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084311634 Original CRISPR ATGCTTTGTAATAGCAATGA AGG (reversed) Intronic
902149506 1:14431613-14431635 CTGCTTTGTTCTAGCAATGCTGG - Intergenic
902190879 1:14762320-14762342 ATGTTTGGTAGTAGCCATGAAGG + Intronic
902650976 1:17837441-17837463 ATATTTTGTAAAAGTAATGAAGG - Intergenic
910028475 1:82687374-82687396 ATGCTTTTCTATAACAATGATGG - Intergenic
910372854 1:86536557-86536579 AAACATTGTAATAGAAATGAAGG - Intergenic
911778121 1:101841135-101841157 GGGCTTTGTAATAGGAAAGAAGG + Intronic
911964665 1:104351156-104351178 ATGCTTTGTTCTATCAAGGAAGG - Intergenic
912119083 1:106447229-106447251 ATGCTTTGTGTTATTAATGATGG + Intergenic
912828877 1:112932286-112932308 ATGCTTTGGAAGACCAATGTAGG + Intronic
914717460 1:150264501-150264523 ATGCTTTTTAACAGAAAAGAGGG - Intronic
915566594 1:156717259-156717281 ATCATTTGTATAAGCAATGATGG - Intergenic
917289918 1:173461261-173461283 ATGCTATGAAACAGCAAAGATGG - Intergenic
919620180 1:199856152-199856174 ATGGTTAGTTGTAGCAATGAAGG - Intergenic
919948062 1:202336679-202336701 ATGCTTTGTGAGAGCAAGAATGG + Intronic
1063914468 10:10867568-10867590 AGGCTTGATAATAGAAATGAAGG - Intergenic
1064645012 10:17452222-17452244 ATGCTGTGAAATTCCAATGAGGG + Intronic
1064851472 10:19713892-19713914 ATGCTCTGCAAGAGCAATAAAGG - Intronic
1065106069 10:22386850-22386872 ATGCTTTGCAATATCACTGAGGG - Exonic
1066578849 10:36857811-36857833 ATACTTTCTAATACCAAGGAGGG + Intergenic
1066637688 10:37522889-37522911 ATGCTTAATAAAAGCAAAGAGGG + Intergenic
1068566153 10:58577779-58577801 ACTCTTTGTAATAACAATGGTGG + Intronic
1069866172 10:71504484-71504506 ATTCTTTGCAATAGCCAAGAAGG - Intronic
1072933217 10:99686324-99686346 CTGCATAGTAATTGCAATGAAGG - Intronic
1075479844 10:122770376-122770398 AGGATTTGTAATAGGAATTAAGG + Intergenic
1078746182 11:14117525-14117547 ATGCTATATAATAACAATGTAGG - Intronic
1079401396 11:20109141-20109163 ATGATTTATAGCAGCAATGATGG + Intronic
1080155915 11:29110721-29110743 AGGATTAGTAATAGCATTGATGG - Intergenic
1080868851 11:36218795-36218817 ATTGTTTGTAATAGCAAAAATGG + Intronic
1084311634 11:68319760-68319782 ATGCTTTGTAATAGCAATGAAGG - Intronic
1085717196 11:78882945-78882967 AATTTGTGTAATAGCAATGAGGG - Intronic
1086462024 11:87015470-87015492 ATGATTTGTTATAAGAATGAGGG + Intergenic
1087491481 11:98832916-98832938 ATTGTTTCTAAGAGCAATGATGG + Intergenic
1089905593 11:122034870-122034892 TTGCTTTCTAAGAACAATGAGGG + Intergenic
1090905106 11:131068060-131068082 ATGCTCTGTAATAGCACTGCTGG - Intergenic
1092955174 12:13542924-13542946 ATGGTCTGGAATGGCAATGAGGG - Exonic
1094454574 12:30618324-30618346 ATGCTTTGCAATATAAATAAAGG - Intergenic
1095088334 12:38082660-38082682 CTGCTTTCTAAGAGCAATTATGG + Intergenic
1097450895 12:59735390-59735412 ATCATTTGTAATACAAATGATGG + Intronic
1098674114 12:73266997-73267019 AGGCTATGAAATAGCAAAGATGG - Intergenic
1099557348 12:84127073-84127095 AAGCTTTATAAAAGCAATCATGG + Intergenic
1101825367 12:108216366-108216388 TTTCTATATAATAGCAATGATGG - Intronic
1106580366 13:31012727-31012749 ATCATTAATAATAGCAATGAAGG - Intergenic
1106957535 13:34957259-34957281 AAGCTTTGTAATAAAGATGAAGG - Intronic
1106981252 13:35284624-35284646 ATCCTTTGAAATAACAATAATGG - Intronic
1107374264 13:39785141-39785163 TTGCTTTGCAACAGCAATGAAGG + Intronic
1107618459 13:42198149-42198171 TTCCTTTGTTATAGCAAAGATGG - Intronic
1107740945 13:43450026-43450048 ATCATTTGTAATAGCAATTTCGG + Intronic
1108173891 13:47772840-47772862 AGGCTGTGAAATAGCAAAGATGG + Intergenic
1108558312 13:51618691-51618713 ATGCAACATAATAGCAATGAGGG - Intronic
1108629561 13:52268645-52268667 AGGCTGTGAAATAGCAAAGATGG + Intergenic
1108656497 13:52537843-52537865 AGGCTGTGAAATAGCAAAGATGG - Intergenic
1109633869 13:65087703-65087725 ATGCTTTCTAATAGCATCCATGG + Intergenic
1109685292 13:65812159-65812181 ATGCTTTGTAAAATCTATGGCGG - Intergenic
1110277381 13:73655331-73655353 ATTTTTTGTAAAGGCAATGAAGG - Intergenic
1110288921 13:73781431-73781453 ACATTTTGTAATAACAATGATGG - Intronic
1111013261 13:82340560-82340582 ATGTTTTGTAATAGCCAAGATGG - Intergenic
1114011916 14:18378178-18378200 TTGCTTTGTACTATGAATGATGG + Intergenic
1114038539 14:18653709-18653731 ATGCTTTATATTAGTAATCAGGG + Intergenic
1115393669 14:32882281-32882303 AAGCTTTGTTAAAGCAATAATGG - Intergenic
1116518395 14:45824868-45824890 ATCCTTTCTAATATCAAGGAGGG + Intergenic
1116921302 14:50578813-50578835 ATTCTTTGAAATAGCATTGCTGG + Intronic
1116936493 14:50745892-50745914 ACGTTGTATAATAGCAATGATGG + Intronic
1119983443 14:79108502-79108524 ATGTTATGTAATAGCTATGAAGG + Intronic
1120396777 14:83977160-83977182 ATTGTTTGTAATAACAATAAAGG - Intergenic
1120687430 14:87554407-87554429 CTGCTTTGTAATAGCCACGCTGG - Intergenic
1126509930 15:49458998-49459020 GTGTTTTTTAATAGAAATGAAGG - Intronic
1127495913 15:59511958-59511980 ATTATTTTTAATAGCAAAGATGG + Intronic
1130112109 15:80974037-80974059 TTTCCTTGTAATAGCAATTATGG + Intronic
1130176096 15:81572940-81572962 ATGTTTGGTTATAGCAGTGATGG - Intergenic
1133611705 16:7439884-7439906 TTGCTTTGTATTAGCAGTCAAGG + Intronic
1134397304 16:13876965-13876987 CTGCTTTGTTCTAGCCATGATGG - Intergenic
1134744134 16:16574296-16574318 ATGCTTTCCCATAGCCATGAGGG - Intergenic
1136452928 16:30364561-30364583 ATGCTTTGGCATAGCATTTAAGG + Intronic
1137416301 16:48284354-48284376 ATGCTATCGAATAGCAATGCAGG + Intronic
1138214407 16:55190666-55190688 TTTGTTTGTAATAGCTATGAGGG + Intergenic
1138802367 16:60048782-60048804 ATCCTTTGTAATTGCAACTAGGG + Intergenic
1140288743 16:73630027-73630049 AGTCTCTGTAATAGAAATGATGG - Intergenic
1140503418 16:75454316-75454338 AGGCTTTATAAGAGCCATGATGG + Intronic
1140834721 16:78782437-78782459 ATGCTGTGGAATACCAATGTTGG - Intronic
1140874170 16:79134986-79135008 ATGATTTGAAATTGAAATGAGGG + Intronic
1144079655 17:11752240-11752262 ATGCTTTGTAATTGCAGTCTTGG - Intronic
1150127470 17:62647637-62647659 ATTATTTACAATAGCAATGATGG - Intronic
1153462296 18:5349740-5349762 ATGTTTTATAATAGCCATTATGG - Intergenic
1154399349 18:14020493-14020515 ATGCTTTTCAAAAGCCATGAGGG + Intergenic
1155071052 18:22316647-22316669 ATGCTTTGTTGTGGCTATGAAGG + Intergenic
1157496245 18:48159504-48159526 ATGATTTGTAGTAGCAAGAAAGG - Intronic
1160215684 18:76927906-76927928 TTGCTTTGTAATGACAATCAGGG + Exonic
1162229983 19:9258551-9258573 ATTTTTTCTAATATCAATGAGGG + Intergenic
1163903061 19:20124681-20124703 AGGCTTTGAAATAGCAAAGGAGG + Intronic
1166242480 19:41503785-41503807 CTGGTTTGTAATATCTATGAAGG - Intergenic
1166985643 19:46658972-46658994 TTACTTTCTAATAGGAATGATGG - Intronic
925927030 2:8678164-8678186 GCGCTTTGTAGTAGTAATGAGGG + Intergenic
930629818 2:53740394-53740416 TTCCTTTGTCATAGCAATAATGG - Intronic
933469314 2:82701046-82701068 AAGTTTTGTAATATCAAAGATGG - Intergenic
934797013 2:97110101-97110123 ATGCTTAGAAAAAGGAATGATGG - Intergenic
934836401 2:97593326-97593348 ATGCTTAGAAAAAGGAATGATGG + Intergenic
935929880 2:108113036-108113058 AGGCTGTGAAATAGCAAAGATGG + Intergenic
936654179 2:114465383-114465405 ATGCATTGCAATAGAAATGATGG - Intronic
937058471 2:118961227-118961249 ATGGTTTGTAATAGGATTGCTGG + Intronic
938525017 2:132121117-132121139 TTGCTTTGTACTATGAATGATGG - Intergenic
939203395 2:139068386-139068408 ATTCTTTGTAAAAACAAAGAAGG + Intergenic
939300029 2:140324303-140324325 ATGCTTTGTGATGGTAAAGATGG - Intronic
939797164 2:146659787-146659809 ATGCTATGTAGTAACATTGATGG + Intergenic
940384981 2:153059811-153059833 AAGCTTTGTCTAAGCAATGACGG + Intergenic
941258421 2:163264283-163264305 ATGCTTTGGAACAGCAATCATGG + Intergenic
942812900 2:180018661-180018683 ATTGTTTGTAATATCCATGAAGG - Intergenic
942905646 2:181177431-181177453 ATGCTTTGTAATATCTGTAAGGG + Intergenic
943539734 2:189197560-189197582 ATGCTTTGTTGTGGCAAGGAAGG + Intergenic
944167866 2:196742607-196742629 AGGCTATGAAATAGCAAAGATGG + Intronic
945752586 2:213806434-213806456 ATGTTTTGTAATGGTAAAGATGG + Intronic
1172352098 20:34251076-34251098 ATGAGTAGTAACAGCAATGAGGG - Intronic
1174902712 20:54517572-54517594 AGGCTTTATAATAACGATGAAGG + Intronic
1177711504 21:24781504-24781526 ATGCTTTGTAGCAGCCATAAAGG + Intergenic
1178047165 21:28708663-28708685 ATGCTAGGTAATAGCAAAAAAGG + Intergenic
1179433532 21:41343580-41343602 ATGCTTTGGAATAGCGAACACGG - Intronic
1179533969 21:42039548-42039570 GTGCTTTGTTACAGCAGTGACGG + Intergenic
1180436408 22:15308986-15309008 TTGCTTTGTACTATGAATGATGG + Intergenic
1180518645 22:16173178-16173200 TTGCTTTGTACTATGAATGATGG + Intergenic
1181957035 22:26595130-26595152 ATGCCTTGTAATAACAAAGGAGG - Intronic
949777294 3:7647264-7647286 ATTCTTTGTAAGAGCAAGGCAGG - Intronic
953123615 3:40070482-40070504 ATGATTTGTAATCTCACTGAGGG - Intronic
954358077 3:50099319-50099341 ATGCATTATAACAGCACTGAAGG - Intronic
956998935 3:74861989-74862011 ATTCTTTGCAACAGCAATCAGGG + Intergenic
957232923 3:77544224-77544246 ATGTTTTCTCATAGAAATGATGG - Intronic
957535417 3:81496467-81496489 ATGCTGTGTACTAGTTATGATGG + Intronic
957626277 3:82656513-82656535 TTCCTTTGTTATGGCAATGATGG + Intergenic
958891349 3:99786602-99786624 GTGCTTTGAAAAAGCAATGCAGG - Intronic
959344485 3:105176011-105176033 ATGCTTTCCAATTTCAATGATGG + Intergenic
959957162 3:112252145-112252167 AGGCTGTGTAACAGCAAAGATGG - Intronic
960172365 3:114477248-114477270 ATGCTTCGTAATGGTAATTATGG - Intronic
960326789 3:116306467-116306489 ATGGCTTGTAATGGGAATGACGG + Intronic
961808507 3:129506774-129506796 ATGCTCTGAATTAGCAATGCAGG - Intronic
965114917 3:164477181-164477203 ATTCTTGTTTATAGCAATGATGG + Intergenic
968998192 4:3958986-3959008 AGACTTTGTAATAGAATTGAAGG + Intergenic
970495772 4:16624051-16624073 ATAATTTGTAATAACAATAATGG - Intronic
971048156 4:22829382-22829404 ATGCGTTGTGATGGCATTGACGG + Intergenic
971436439 4:26630102-26630124 CTACTTTTTAATAACAATGAAGG - Intronic
971670747 4:29553633-29553655 ATTCTTTGTAATTAAAATGAAGG - Intergenic
973135893 4:46706611-46706633 ATCATTTCTAATAGTAATGAAGG + Intergenic
973156802 4:46965266-46965288 GTGCTTTTTAATACAAATGATGG - Intronic
973198334 4:47471701-47471723 GAGTTTTGTAACAGCAATGACGG - Intergenic
973870745 4:55163675-55163697 AAGCATTGAAATAGCAAAGAAGG + Intergenic
974973654 4:68862677-68862699 ATGCTTTTTAATAGAAAAAAAGG + Intergenic
975088309 4:70369913-70369935 AGGTTTAGAAATAGCAATGAAGG + Intergenic
975431455 4:74296204-74296226 ATTCTTTGTTATGGCAATCAAGG - Intronic
975675353 4:76822379-76822401 TTGCTATGTATTAGCCATGAAGG + Intergenic
976160785 4:82196536-82196558 ATGCATTTTAATAGGAATGTCGG + Intergenic
976495384 4:85723430-85723452 ATGATTTAGAATAGCAATGTTGG - Intronic
977186238 4:93940762-93940784 ATACTTAGTAATGGCAATGTGGG + Intergenic
977243416 4:94601556-94601578 ATTTTTTGTAAGAGCAAAGAAGG - Intronic
977306493 4:95329341-95329363 CTGCTATGCAACAGCAATGAAGG + Intronic
978042395 4:104084185-104084207 TTGCTTTGTAAGAACAAAGATGG + Intergenic
978542991 4:109838727-109838749 AGCCTTTGTAGTAGCAATGCTGG - Intronic
979942790 4:126783313-126783335 ATGCTTTGATATATCTATGATGG + Intergenic
980431366 4:132702081-132702103 ATGCCTTCTAGTAGCAATTACGG - Intergenic
980645254 4:135635598-135635620 AGGCTGTGTAAAAGCAAAGATGG + Intergenic
981421556 4:144555960-144555982 ATGTTTGGTTATAGAAATGAAGG - Intergenic
983728697 4:170965680-170965702 ATGCTTAGTAACAATAATGAGGG - Intergenic
984631791 4:182068448-182068470 TTGCTTAGTAGTAGCAATGTAGG - Intergenic
985199267 4:187467358-187467380 ATGGATTGCTATAGCAATGAGGG + Intergenic
988262289 5:28903633-28903655 ATGCCTTGTATTAACAAAGAGGG + Intergenic
989511409 5:42292022-42292044 ATGATTTGTTATAGCAATAATGG + Intergenic
989815370 5:45730069-45730091 AAACATTGTAATAGAAATGAAGG + Intergenic
990744752 5:58948430-58948452 AAGATTTGTAGTAGTAATGAAGG - Intergenic
991323433 5:65402643-65402665 ATTCATTGTGATAGCAAGGAGGG - Intronic
991561128 5:67954650-67954672 CTGCGTTGTAGTAGCCATGAGGG - Intergenic
992880841 5:81107896-81107918 ATGCTTTGTAGTTGAAATAATGG + Intronic
993226130 5:85168676-85168698 AGGCTGTGAAATAGCAAAGATGG + Intergenic
993964240 5:94341494-94341516 ATCATTTGTCACAGCAATGAGGG + Intronic
994381515 5:99077521-99077543 AAGCTCTGTAATAGAAATGAAGG - Intergenic
995551015 5:113281198-113281220 TTGCTTTGAAGCAGCAATGATGG - Intronic
995860041 5:116631248-116631270 ATTGTTTATAATAGCAATAAAGG + Intergenic
996221556 5:120938416-120938438 TTGCTTTTTAATAGCTATTAAGG - Intergenic
997682538 5:135766338-135766360 ATGGTTTGTAATATCAAGGGGGG + Intergenic
997686254 5:135789501-135789523 ATGGTTTGTAATATCCAGGAGGG + Intergenic
999524629 5:152391076-152391098 TTTCTTTGTATCAGCAATGAGGG + Intergenic
999968620 5:156836217-156836239 ATGCTTTGTAATAGGTATAGAGG - Intergenic
1000028464 5:157380848-157380870 AAGCTTAGACATAGCAATGAAGG + Intronic
1000188254 5:158881989-158882011 CTGCTTTGTATTTGCAAAGAAGG + Intronic
1001861908 5:175063256-175063278 ATGCCTTGAGATATCAATGAAGG - Intergenic
1005309601 6:24546953-24546975 ATGCTTGTTAATAGAAATAAAGG - Exonic
1007319552 6:41017719-41017741 AAGCTCTGTCATAGCAAGGAGGG - Intergenic
1008667667 6:53732280-53732302 CTGCATTGAAATAGCAAGGAAGG - Intergenic
1009028458 6:58028023-58028045 ATACTTTGTGATAACACTGAAGG + Intergenic
1009367221 6:62864890-62864912 ATGATTTGTAATATCCAGGATGG - Intergenic
1010162426 6:72872452-72872474 CTGCTCTGAAATAGCAATCATGG + Intronic
1012323608 6:97884999-97885021 ATGATTTTTATTAGCTATGACGG + Intergenic
1013802305 6:113961706-113961728 ATGCTTTGTAATAACACTAGTGG - Intronic
1015056883 6:128913323-128913345 ATGATTGGTTATATCAATGATGG - Intronic
1016423705 6:143912585-143912607 AGGCTGTGAAATAGCAAAGATGG + Intronic
1016723586 6:147332370-147332392 AGGATTTGAAATATCAATGATGG + Intronic
1021355105 7:19644591-19644613 ATGCTTTGTTCTAGCCATGCTGG - Intergenic
1021819589 7:24483303-24483325 CTGCTTTGTGACTGCAATGATGG + Intergenic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1025957412 7:66193528-66193550 ATGCTTAGTAAAAGCACTCAAGG - Intergenic
1029946751 7:104541250-104541272 ATGGGTGGTAAAAGCAATGATGG - Intronic
1030411448 7:109185643-109185665 AATCTTTGTAATATCAATGTCGG + Intergenic
1032435136 7:131894690-131894712 ATGATATGTAAGAGAAATGATGG - Intergenic
1032775621 7:135109845-135109867 AGGCTGTGAAATAGCAAAGACGG + Intronic
1034005088 7:147463011-147463033 ATGCTTTGTTTTAGTAAAGATGG - Intronic
1034679012 7:152913922-152913944 ATGCCCTATAATAGCAAAGAGGG + Intergenic
1036056029 8:5254806-5254828 ATGCTATTCAACAGCAATGACGG - Intergenic
1038879612 8:31593607-31593629 GTGCTTTGTAAAAGCAATGATGG + Intergenic
1038982430 8:32774572-32774594 GTGCTATGAGATAGCAATGAAGG - Intergenic
1039011342 8:33096746-33096768 ATGCTATGGAATATGAATGAGGG + Intergenic
1039254112 8:35700103-35700125 AGGCCTTGTATTAGCAGTGAAGG - Intronic
1039540605 8:38364817-38364839 ATTCTTTGTGATGGCTATGAGGG - Intronic
1039599125 8:38819403-38819425 ATGCTTAATAAAAGCAAAGAGGG + Intronic
1041205740 8:55496133-55496155 ATGTTAAGTAATAGTAATGAGGG + Intronic
1041603875 8:59756884-59756906 ATGATTTGCAATAGCAAAGAAGG - Intergenic
1043307565 8:78816043-78816065 TTGCTTTGTGATTGCCATGAGGG + Intergenic
1043971923 8:86539626-86539648 ATTGATTTTAATAGCAATGAGGG - Intronic
1044530861 8:93306167-93306189 ATGCTATGTAATAGAGATCAAGG - Intergenic
1050599113 9:7233152-7233174 ATTCTTTGTAATATCCCTGAGGG - Intergenic
1051232088 9:14964886-14964908 ATTGTTTGTAATAGCCAGGAGGG - Intergenic
1053703734 9:40728569-40728591 TTGCTTTGTACTATGAATGATGG - Intergenic
1054413816 9:64852178-64852200 TTGCTTTGTACTATGAATGATGG - Intergenic
1056063745 9:82911515-82911537 ATGGTTTGTAATAAAAATTAAGG + Intergenic
1056078593 9:83065939-83065961 ATTCTTTGTAATGGGAAGGAGGG - Intergenic
1057736067 9:97662126-97662148 ATACTTTGCAAGAGCACTGAAGG - Exonic
1187818237 X:23256394-23256416 AGGCTGTGAAATAGCAAAGATGG - Intergenic
1187957495 X:24534080-24534102 ATACTTTGTAATGGAAATCAAGG - Intronic
1189512025 X:41672275-41672297 ATGCTTTGTGATAACAATGAGGG + Intronic
1189774968 X:44462396-44462418 CTGCTTTGGAATAGCAATCTTGG - Intergenic
1192698396 X:73442967-73442989 ATGCTTAGCAATTGGAATGAAGG - Intergenic
1194058885 X:89172327-89172349 CTGCTTTGTTTTAGCAATGCTGG - Intergenic
1194067780 X:89283911-89283933 AGGCTGTGTAACAGCAAAGATGG + Intergenic
1194318735 X:92415455-92415477 ATGCATTGTAATTGCATTGATGG - Intronic
1199381610 X:147178738-147178760 ATGCTTTGTAAGAACATGGAAGG + Intergenic
1200626871 Y:5528611-5528633 ATGCATTGTAATTGCATTGATGG - Intronic
1200721926 Y:6618071-6618093 AGGCTGTGTAACAGCAAAGATGG + Intergenic
1201748142 Y:17403054-17403076 CTGCATTGTAATAGGAATGTCGG - Intergenic
1202107624 Y:21386743-21386765 ATGCTTTCTAATAGAAAACAGGG + Intergenic