ID: 1084312320

View in Genome Browser
Species Human (GRCh38)
Location 11:68324294-68324316
Sequence TATCCCACCCCACTAGGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084312320_1084312322 -3 Left 1084312320 11:68324294-68324316 CCGGGACCTAGTGGGGTGGGATA 0: 1
1: 0
2: 1
3: 9
4: 94
Right 1084312322 11:68324314-68324336 ATAGTGAGAGCTGCGTCCACAGG 0: 1
1: 0
2: 3
3: 123
4: 113
1084312320_1084312327 28 Left 1084312320 11:68324294-68324316 CCGGGACCTAGTGGGGTGGGATA 0: 1
1: 0
2: 1
3: 9
4: 94
Right 1084312327 11:68324345-68324367 AGAGACTTGTGTGCCCAGTGTGG 0: 1
1: 0
2: 3
3: 13
4: 207
1084312320_1084312324 -1 Left 1084312320 11:68324294-68324316 CCGGGACCTAGTGGGGTGGGATA 0: 1
1: 0
2: 1
3: 9
4: 94
Right 1084312324 11:68324316-68324338 AGTGAGAGCTGCGTCCACAGGGG 0: 1
1: 0
2: 2
3: 21
4: 262
1084312320_1084312325 2 Left 1084312320 11:68324294-68324316 CCGGGACCTAGTGGGGTGGGATA 0: 1
1: 0
2: 1
3: 9
4: 94
Right 1084312325 11:68324319-68324341 GAGAGCTGCGTCCACAGGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 190
1084312320_1084312323 -2 Left 1084312320 11:68324294-68324316 CCGGGACCTAGTGGGGTGGGATA 0: 1
1: 0
2: 1
3: 9
4: 94
Right 1084312323 11:68324315-68324337 TAGTGAGAGCTGCGTCCACAGGG 0: 1
1: 0
2: 1
3: 14
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084312320 Original CRISPR TATCCCACCCCACTAGGTCC CGG (reversed) Intronic
900638903 1:3678948-3678970 TTTCCCACCCCACATGCTCCTGG + Intronic
902664238 1:17926405-17926427 TCTCCCACCCCACTCAGTCTGGG + Intergenic
904182016 1:28672699-28672721 TATCCCTCCCCACTCTGGCCTGG + Intronic
906904204 1:49871014-49871036 TATTCAACCCCACTAGGCCCAGG + Intronic
907485457 1:54774881-54774903 TATCCCAGCCTCCTAAGTCCTGG - Intergenic
907824166 1:57999488-57999510 AATCCCACCCCACTATTTCCTGG - Intronic
910018538 1:82556560-82556582 CCTCCCTCCCCACAAGGTCCTGG - Intergenic
916334281 1:163652635-163652657 TATCCCTCCCCACTAGATTTTGG - Intergenic
921944056 1:220874449-220874471 TGTCCCAGCCCACCAGGCCCGGG - Intergenic
1063725757 10:8635675-8635697 TATCCCACCCCAATAGGAGGCGG - Intergenic
1067376010 10:45727853-45727875 TTTCCCACCCCATTTAGTCCAGG - Intronic
1067883710 10:50068541-50068563 TTTCCCACCCCATTTAGTCCAGG - Intronic
1069921646 10:71819220-71819242 ATTCCCAGCCCACTGGGTCCTGG + Intronic
1073134923 10:101215152-101215174 TCTCCCACCCCTCCAGGTCCTGG - Intergenic
1076001289 10:126915050-126915072 TTTCCCACCCCACTTGCTGCAGG - Intronic
1079095842 11:17509637-17509659 CAACCCACCCCACAAGGTCCCGG - Exonic
1080608015 11:33880502-33880524 TATCCCCTCCCCCTAGCTCCTGG - Intronic
1081806622 11:45894389-45894411 TAACCCACCCCAGTAGAGCCAGG + Intronic
1081813149 11:45924333-45924355 TCTCCAACCCCACCAGGTCTTGG - Intronic
1082805391 11:57446084-57446106 TATCCCATATCCCTAGGTCCAGG - Intergenic
1084312320 11:68324294-68324316 TATCCCACCCCACTAGGTCCCGG - Intronic
1087195407 11:95299785-95299807 TATCACACCCCCTTAGATCCTGG - Intergenic
1089257520 11:117201688-117201710 TATCACACCCCACTGGTCCCAGG - Intronic
1091461243 12:644868-644890 TATCCAAACCCACTGGGGCCAGG - Intronic
1094655777 12:32418589-32418611 CACCCCACCCCCCAAGGTCCAGG - Intronic
1095668781 12:44834735-44834757 CATCCCACCCCAGCAGATCCCGG + Intronic
1096465439 12:51845923-51845945 TACCCCACCCCCCCAAGTCCGGG - Intergenic
1098435352 12:70462911-70462933 TATTCAACCCCTCTAGGCCCAGG - Intergenic
1101895629 12:108754345-108754367 CATCACACTCCACTGGGTCCTGG + Intergenic
1101946146 12:109139036-109139058 ATCCCCATCCCACTAGGTCCTGG + Intronic
1102234526 12:111285950-111285972 TATCAGACCCCACTGTGTCCTGG + Intronic
1102454090 12:113060891-113060913 TACCCAACCCAGCTAGGTCCCGG - Intronic
1103209136 12:119154136-119154158 TTTCCCACCCCACTGGGTCACGG - Intronic
1106419869 13:29577296-29577318 ACTCCCACCCAACTAGGTCAGGG + Intronic
1107857588 13:44631125-44631147 TATCCCACCCCAGTGTGCCCAGG + Intergenic
1111510112 13:89250215-89250237 TAGCCCACCCCATTTGGTCATGG - Intergenic
1117187649 14:53257418-53257440 TATTCAACCCCTCAAGGTCCAGG - Intergenic
1121313212 14:92946208-92946230 TCTCCCTCACCACGAGGTCCGGG - Intronic
1202849749 14_GL000225v1_random:9216-9238 TGTCCCACCGCACAAGGGCCCGG - Intergenic
1131749814 15:95494184-95494206 TAGCCCACCCAGCTCGGTCCTGG - Intergenic
1134647471 16:15881654-15881676 TCCCCCACCCCACCAAGTCCAGG + Intronic
1139295621 16:65897943-65897965 TATCCCAGCCCAAGAGGTCAAGG - Intergenic
1141659237 16:85432912-85432934 TCTGCCACCCCAGTAAGTCCTGG - Intergenic
1147538299 17:41335057-41335079 TCCCCCTCCCCACAAGGTCCAGG - Intergenic
1150635901 17:66913080-66913102 TCTCCCACTCCCCTAGCTCCTGG - Intergenic
1151229925 17:72677212-72677234 ACTCCCACCCCACTAGGGTCAGG - Intronic
1151889185 17:76942127-76942149 TATCCCTCCCCACTCTGTCTAGG - Intronic
1152528248 17:80901965-80901987 TATCCTGCCCCACCAGGGCCAGG - Intronic
1152556139 17:81054137-81054159 GCTCCCACCCCACGGGGTCCGGG - Intronic
1152719949 17:81918550-81918572 CATCCCACCCCAGCAGATCCCGG + Exonic
1155339376 18:24798676-24798698 TCACCCACCCCACTATGTACAGG - Intergenic
1155464410 18:26119856-26119878 AAACCCACTCCACTAGGGCCTGG + Intergenic
1159256305 18:65951851-65951873 TAACCCTCTTCACTAGGTCCAGG - Intergenic
1166220010 19:41358035-41358057 CCTCCCACCCCTCTATGTCCCGG - Intronic
926236976 2:11052966-11052988 TATACCACCACACTAGCTCCCGG + Intergenic
935831304 2:107003392-107003414 GATCCCATCCCACGAGGTCCAGG + Intergenic
936040261 2:109144676-109144698 TATGCCACTGCACTGGGTCCAGG + Intronic
936777975 2:115996788-115996810 TTTCCCACCCCAACAGGCCCTGG + Intergenic
937197646 2:120173926-120173948 TCTCCCACCTCACTAAGTGCTGG + Intronic
939254673 2:139727664-139727686 TATTCAACCCCTCTAGGCCCAGG + Intergenic
942457709 2:176149371-176149393 TGCCCCACCCCACCAGGCCCAGG + Intergenic
943528587 2:189050264-189050286 TATCCCCCTCCTCTAGCTCCGGG + Intronic
946827093 2:223690279-223690301 TATCCCACCCCACCCGCTACTGG + Intergenic
948792540 2:240386394-240386416 GATGCCAGCCCACTAGGACCTGG + Intergenic
1170659832 20:18326601-18326623 TATTCAACCCCTCTAGGCCCAGG + Intergenic
1171366762 20:24630291-24630313 TGTCCCAGTCCTCTAGGTCCCGG - Intronic
1172398988 20:34632826-34632848 TATCCTACCCCAGTCTGTCCTGG - Intronic
1173058892 20:39642987-39643009 TATCCCAACCAAATAGGTTCTGG + Intergenic
1173202106 20:40961766-40961788 CAGCCCATCCCACAAGGTCCAGG + Intergenic
1173853292 20:46232565-46232587 TTTGCCACCCCACTGGGTCTGGG + Intronic
1179427602 21:41294276-41294298 TATCCCACCTCAGGAGGACCAGG - Intergenic
1181809223 22:25393226-25393248 TGTCCCAGCCCACTAGGTCCCGG + Intronic
1184152937 22:42649126-42649148 CACCCCACCCCACAAGGGCCTGG - Intronic
953802770 3:46039721-46039743 TATTCCATCCCTCTAGGCCCAGG + Intergenic
954384510 3:50237165-50237187 TAGCCCAGCCCACTTGGTGCAGG - Intronic
962848440 3:139290219-139290241 TAGCCTAGCCCAGTAGGTCCTGG - Intronic
965610983 3:170543689-170543711 TTTCCCAACCCTCTTGGTCCTGG - Intronic
978456040 4:108892986-108893008 TATCCCACCCTAATTGGTGCCGG - Intronic
982326651 4:154135748-154135770 TCCCGGACCCCACTAGGTCCAGG - Intergenic
985639404 5:1056691-1056713 CATCCCACCCCACAGGGCCCAGG + Intronic
991466737 5:66921339-66921361 TACCTCACCTCATTAGGTCCAGG - Intronic
997526228 5:134554995-134555017 TGGCCCAGCCCACTAGGCCCCGG - Intronic
1000216256 5:159159635-159159657 TATCCCACTTCAGTAGGTCTTGG - Intronic
1002271952 5:178078333-178078355 TCTCCCAGCCCTCTAGGGCCGGG - Intergenic
1002928308 6:1617706-1617728 TTTCCCAGCCGACTAGGACCTGG - Intergenic
1006029064 6:31165854-31165876 TGCCCCTCCCCACTAGGTTCAGG + Intronic
1006311511 6:33264388-33264410 TATCCAACCCCCCTAGGCGCTGG + Exonic
1014169349 6:118261831-118261853 TATCCCACCCCTCTGGGGCTGGG + Intronic
1018382319 6:163269630-163269652 TATCCCACCCCACCAAGTTAAGG + Intronic
1023871138 7:44263597-44263619 CCTCCCACCCCACAAGGTGCGGG + Intronic
1024542486 7:50489640-50489662 TATTCAACCCCTCTAGGCCCAGG + Intronic
1028932276 7:96426733-96426755 TATTCCAACCCTCTAGGTCTTGG - Intergenic
1032493530 7:132343403-132343425 TTTCCCCTCCCACAAGGTCCTGG + Intronic
1032871036 7:135985565-135985587 TATTCAACCCCTCTAGGCCCAGG - Intergenic
1041765256 8:61412111-61412133 ATTCACACCACACTAGGTCCTGG + Intronic
1045497322 8:102719515-102719537 TCTCCCACCCCACTAGGGCAGGG + Intergenic
1048127896 8:131657336-131657358 TATCCCACTACACTAGGATCTGG + Intergenic
1048355473 8:133650342-133650364 CCTCCCTCCCCACAAGGTCCTGG - Intergenic
1055529614 9:77171016-77171038 TTTCCCACCCCACTCCATCCTGG + Intergenic
1057483231 9:95462049-95462071 CAGCCCACCCCGCTAGGACCAGG - Intronic
1062483457 9:136763086-136763108 GCTCCCACCCCACCCGGTCCTGG + Intronic
1062607223 9:137353701-137353723 TCTCCCTCCCCGCAAGGTCCTGG + Intronic
1186664274 X:11702639-11702661 TGTCCCACCTCACTAGTTCCTGG - Intergenic
1198792622 X:140362112-140362134 TATCCCCTCCCCCTAGCTCCTGG - Intergenic
1201063123 Y:10066052-10066074 TATCCCAGCAAACTGGGTCCTGG + Intergenic