ID: 1084313065

View in Genome Browser
Species Human (GRCh38)
Location 11:68327702-68327724
Sequence GAAAGTGTGACAGGCGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084313059_1084313065 4 Left 1084313059 11:68327675-68327697 CCAGAAGCAGCTCCCACATGAGA 0: 1
1: 0
2: 2
3: 16
4: 182
Right 1084313065 11:68327702-68327724 GAAAGTGTGACAGGCGTGGAGGG 0: 1
1: 1
2: 1
3: 29
4: 189
1084313060_1084313065 -8 Left 1084313060 11:68327687-68327709 CCCACATGAGACTCAGAAAGTGT 0: 1
1: 1
2: 0
3: 17
4: 449
Right 1084313065 11:68327702-68327724 GAAAGTGTGACAGGCGTGGAGGG 0: 1
1: 1
2: 1
3: 29
4: 189
1084313061_1084313065 -9 Left 1084313061 11:68327688-68327710 CCACATGAGACTCAGAAAGTGTG 0: 1
1: 1
2: 0
3: 12
4: 191
Right 1084313065 11:68327702-68327724 GAAAGTGTGACAGGCGTGGAGGG 0: 1
1: 1
2: 1
3: 29
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084313065 Original CRISPR GAAAGTGTGACAGGCGTGGA GGG Intronic
900276835 1:1835535-1835557 GAAAGTGTGGCAGGTGAGGCAGG - Intronic
901123292 1:6912080-6912102 TCTAGTGTGACAGGCCTGGAGGG + Intronic
901719499 1:11185112-11185134 GACAGTGTGACATGCTAGGATGG - Intronic
902407833 1:16195661-16195683 GAAGTTGTGAAAGGGGTGGATGG + Intergenic
902679823 1:18035305-18035327 GACAGGATGACAGGGGTGGAAGG + Intergenic
905004575 1:34699417-34699439 GAAAGTGGGAAAGGCTTGCATGG + Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
905819863 1:40980480-40980502 GAAACTGTAACGAGCGTGGACGG - Intronic
906104792 1:43285380-43285402 GAAAGTGTGACCTGGGGGGAGGG - Intronic
906913807 1:49985180-49985202 GAATGTGGGGCAGGCGGGGAAGG - Intronic
907677777 1:56534575-56534597 GCAAGAGTGACAGACGTGGAGGG - Intronic
909285010 1:73805137-73805159 GAAAGTGTGACAGATGTCAAAGG - Intergenic
910232241 1:84998195-84998217 GAAAGTGCGACCGGCGCGCAAGG + Intergenic
910650735 1:89563913-89563935 GAAAATGTGAGAGACTTGGAAGG - Intronic
913082978 1:115406887-115406909 GAAAGTGTTAGTGGTGTGGATGG - Intergenic
913348601 1:117832610-117832632 GAAAGTGTGATAGGAGATGAGGG - Intergenic
915092646 1:153437314-153437336 GTAAGTGGGACAGGAGTGGGTGG + Intronic
920392388 1:205616568-205616590 GAAAATGGGCCAGGGGTGGAAGG + Exonic
920658292 1:207892898-207892920 GAAACTGTGCAAGGGGTGGAGGG - Intronic
921693924 1:218184998-218185020 GAAAGTGTGATAACAGTGGACGG - Intergenic
923121063 1:230991963-230991985 AACAGTGTGGCAGCCGTGGAGGG - Intronic
1063860973 10:10307434-10307456 GAAAGTGTGAAAGGGATGGGGGG - Intergenic
1064478653 10:15718984-15719006 GACACTGGGGCAGGCGTGGAGGG + Intronic
1065326785 10:24556671-24556693 GAAAGTGTGCTAGGCCTGGCAGG - Intergenic
1066001048 10:31104260-31104282 GAAAGCATTACAGGCCTGGAGGG - Intergenic
1068560977 10:58513513-58513535 GGAAATCTGAGAGGCGTGGAAGG - Intronic
1072288058 10:93935679-93935701 GAGAGTGTGAAAAGGGTGGAAGG + Intronic
1074281218 10:112053376-112053398 GAAAATGGGACAGGAGTGGCCGG - Intergenic
1074722438 10:116274169-116274191 GAGCGTGTGTCAGGCGTGGGGGG - Intergenic
1076836621 10:133024187-133024209 GAAAGTGTGAAAGACGTGACTGG + Intergenic
1078145373 11:8718645-8718667 GGAGGTGTGAAAGGCTTGGAAGG + Intronic
1078395181 11:10974876-10974898 GAAAGTGTGACTGGAGCTGAAGG + Intergenic
1079791175 11:24741555-24741577 GAAAGTGTGACTGGGGGGCAAGG - Intronic
1079923501 11:26461430-26461452 GAAGGTGTGAAAGGAGTGGGGGG - Intronic
1084313065 11:68327702-68327724 GAAAGTGTGACAGGCGTGGAGGG + Intronic
1084465509 11:69320823-69320845 GAGAGAGTGAGAGGTGTGGACGG + Intronic
1084666563 11:70579558-70579580 GAATGTAAGACAGGCATGGATGG + Intronic
1085952354 11:81347356-81347378 CAAAGTGTGACAGGACTGGAGGG + Intergenic
1090851732 11:130576591-130576613 GAGAGTGAGACAGGTGTGGATGG + Intergenic
1092907595 12:13116113-13116135 GAAAGAGAGAGAGGCTTGGAAGG - Intronic
1096405349 12:51340061-51340083 GAAGGTGTGGCAGGGGTGGAAGG - Intronic
1096536240 12:52276892-52276914 GCAAGTGTCTCAGGCTTGGAAGG + Intronic
1096608971 12:52788687-52788709 GGCAGTGTGACATGCCTGGAAGG + Intergenic
1097766632 12:63533997-63534019 GAAAGGGTTACAAGAGTGGATGG - Intergenic
1097782970 12:63728924-63728946 GAAAGGGTTACAAGAGTGGATGG - Intergenic
1097937263 12:65266683-65266705 GACAGGGTGGCAGGCGGGGAAGG + Intergenic
1100403201 12:94250152-94250174 GCCAGTGTGACTGGAGTGGAGGG + Intronic
1101897534 12:108767767-108767789 TAAAGTCAGACAGGCCTGGAAGG + Intergenic
1104064736 12:125297319-125297341 GATAGGGTGACAGGTGTGGATGG + Intronic
1104302281 12:127575378-127575400 GAAGGTGGGAGAGGCGAGGAAGG - Intergenic
1104388950 12:128375220-128375242 GACAGTGTGACCGGGGTGGGCGG + Intronic
1110136349 13:72071983-72072005 GTAAGTGTGACAGACTTGGATGG + Intergenic
1110688280 13:78401173-78401195 CACAGTGTGACAGCTGTGGACGG + Intergenic
1111996314 13:95169102-95169124 GAAAGTGGGAGAGGCGAGGAAGG + Intronic
1112322986 13:98423954-98423976 GGAAGAGAGAGAGGCGTGGAGGG - Intronic
1112339261 13:98538920-98538942 GAAATTGTGACAGGTGGCGAGGG - Intronic
1112386781 13:98946993-98947015 AAAAGTGAGACAGGCATGAAAGG - Intronic
1112540473 13:100306753-100306775 GAAAGTGTTACAGACATGAAAGG + Intronic
1114535665 14:23420747-23420769 GAAAAGGTCACAGGCCTGGAGGG - Intronic
1119568390 14:75648214-75648236 GAATGTGTGACAGTCTTGCAGGG - Intronic
1119632293 14:76243659-76243681 GAAAGTCTGACAGGTGTTCAGGG - Intronic
1119951639 14:78751683-78751705 GAAAGTGTGCCTGCCCTGGAGGG + Intronic
1120584906 14:86300229-86300251 GTTAGTGTGACAGGTGTGGACGG + Intergenic
1120744271 14:88139917-88139939 GAAAGTTTGACAGAACTGGAAGG - Intergenic
1122562508 14:102626353-102626375 GAAAGTGAGACAGGAAAGGAGGG + Intronic
1122659501 14:103285389-103285411 GAACGTGTCCCAGGCGTGTATGG + Intergenic
1123436682 15:20259750-20259772 GAAAATGTGCCAGGCATGGGTGG - Intergenic
1123980381 15:25596778-25596800 GCAAGGCTGACGGGCGTGGACGG + Intergenic
1127643420 15:60936446-60936468 GAAGGTGTGACAGGTGTGCAAGG - Intronic
1128472181 15:67963937-67963959 CAAAGTGAGCCAGTCGTGGAAGG - Intergenic
1131565139 15:93478840-93478862 GAGAGTATGTCTGGCGTGGAGGG + Intergenic
1132354447 15:101160719-101160741 GAAAGTGAGAGAGTGGTGGATGG - Intergenic
1135933221 16:26757179-26757201 GAAAGTGTGAAGGGAGTGGCTGG + Intergenic
1136847887 16:33591103-33591125 GAAAATGTGCCAGGCATGGGGGG + Intergenic
1138473610 16:57257663-57257685 TGAAGGGTGACAGGCGTGGAGGG + Intronic
1138581287 16:57942166-57942188 GAGAGTGGGCCAGGCGTGGTGGG - Intronic
1203109595 16_KI270728v1_random:1439752-1439774 GAAAATGTGCCAGGCATGGGGGG + Intergenic
1144329682 17:14212516-14212538 GAGAGTGTCACAGGCGAGGTTGG - Intergenic
1146371184 17:32266310-32266332 GAAAGTTTGCCGGGCGGGGAGGG - Intronic
1146914551 17:36670123-36670145 GAAAGTGAGAGAGGATTGGAGGG + Intergenic
1148030465 17:44616780-44616802 GAAAGGGAGACAGACCTGGAAGG - Intergenic
1150581895 17:66481713-66481735 GAAAGTCTGGCAGGCCTGGGAGG - Intronic
1150980754 17:70138989-70139011 TAAAGAGTGACAGACATGGAGGG + Intergenic
1151152965 17:72103981-72104003 GAAAGGGTGAAAGGCGAAGAGGG + Intergenic
1152214406 17:79024189-79024211 GAAAGTGGGACAGACGCGCAAGG - Exonic
1157099816 18:44719340-44719362 GAATGTGTGCAAGGGGTGGAGGG + Intronic
1161647859 19:5465418-5465440 GAGAGTGTGGCTGGTGTGGACGG + Intergenic
1163134429 19:15299382-15299404 GGAAGTGTGTCAGGCTTTGATGG - Intronic
1165791711 19:38496593-38496615 GAAAGTGGGGCAGGCCTGGACGG - Intronic
1166419110 19:42620964-42620986 GAAAGTGGGGCAGGCATGGAAGG - Intronic
1166716789 19:44973537-44973559 GAGAGTGTGAGAGGTGGGGAGGG + Intronic
1168430074 19:56271706-56271728 GAAAGAGTTCCAGGTGTGGAGGG - Intronic
928472267 2:31586186-31586208 GAAAGTGTGAGAGGGGAGTAGGG - Intergenic
930086989 2:47504554-47504576 GAAAATGAGACACGCGTGGAGGG + Intronic
932210909 2:69929187-69929209 GAAAGTGTAACAGGCTGGGCCGG - Intronic
934056461 2:88255237-88255259 GAAAGTGGGACTGGGGTGAATGG - Intergenic
934577981 2:95414970-95414992 GAGTGTGTGAGAGGGGTGGAGGG - Exonic
935828614 2:106976403-106976425 GACACTGAGACATGCGTGGAGGG + Intergenic
936023644 2:109014706-109014728 GCACGTGTGAGAGGCGTGCAGGG + Intergenic
938548975 2:132361837-132361859 AGCAGTGTGACAGGTGTGGAAGG + Intergenic
938853513 2:135286213-135286235 GAAAGGGTGAGAGGGGTGTAAGG - Intronic
940070031 2:149676508-149676530 GAAAGTGAGAAAGGAATGGAAGG + Intergenic
944174144 2:196811152-196811174 GAAATTATGCCAGGCGTAGAGGG + Intergenic
944291051 2:198005662-198005684 GAATGTGTAACAGGTGTGGGCGG + Intronic
945649788 2:212542717-212542739 GAAAGTGTGAGAGATCTGGAAGG - Intergenic
1168802161 20:650529-650551 TTAAGTGTGAGCGGCGTGGAAGG + Intronic
1169823072 20:9735288-9735310 GAAAGTGAGGCAGGAGTGAAAGG + Intronic
1170570410 20:17629308-17629330 GAAAGGGTGACAGGGATGGAGGG - Intronic
1171877798 20:30594398-30594420 AGCAGTGTGACAGGTGTGGAAGG + Intergenic
1173410359 20:42804281-42804303 AAAAGTGGGACAGGGGAGGAGGG - Intronic
1173480959 20:43399040-43399062 GACAGAGTGAGAGGCATGGAAGG - Intergenic
1174107490 20:48172907-48172929 GAGAGTGTGCCAGGAGTGGAGGG + Intergenic
1178509509 21:33192573-33192595 GAAAGTGTGACAGGTTTCTAGGG - Intergenic
1178593832 21:33934873-33934895 GAAAGTGTGACAGGTTTCTAGGG + Intergenic
1180197077 21:46203390-46203412 CAAAGTGGGCCAGGCGTGAAAGG + Intronic
1181694764 22:24587508-24587530 CAAGGTGGGACAGGGGTGGAGGG + Intronic
1181808494 22:25389814-25389836 GAAAGTGTGGCAGGCATGGAAGG - Intronic
1182931125 22:34175277-34175299 GAAAGTGTTCTAGGCTTGGATGG + Intergenic
1203257561 22_KI270733v1_random:151385-151407 GAGAGAGAGACAGACGTGGAGGG - Intergenic
950077044 3:10194686-10194708 GACAGTGGGACAGGCATGCATGG + Intronic
955882716 3:63564979-63565001 GGAAATGTGACAAACGTGGATGG - Intronic
961954007 3:130781763-130781785 GAAAGTCTGACAAGTGTCGATGG + Intergenic
961980605 3:131074107-131074129 GGAAGTGAGACAGGAGGGGAAGG - Intronic
962416297 3:135185209-135185231 GAATGTGTGATATGTGTGGATGG + Intronic
963867434 3:150377979-150378001 GAGATTGTGACAGGCCTGGGAGG - Intergenic
964941201 3:162158947-162158969 GAAAGTGGAAAAGGCGTGGGAGG + Intergenic
965211118 3:165790844-165790866 GACAGTGTGACTAGAGTGGAGGG + Intronic
970873850 4:20847078-20847100 CAAAGTGGGACAGTCGTGGTTGG - Intronic
971355388 4:25890553-25890575 CAGAGTGTGACAGGCGAGGCAGG - Intronic
972768933 4:42177898-42177920 GAAAGTTTGAGTGGCCTGGATGG - Intergenic
973323255 4:48831314-48831336 GAAGGTGCGAAAGTCGTGGATGG - Exonic
975847064 4:78535897-78535919 GTCAGTGTGACAAGAGTGGAGGG - Intronic
975979096 4:80135318-80135340 GAAAGTTTGACAGGCGTGCGTGG + Intergenic
978341981 4:107728713-107728735 GAAATTCTCACAGGTGTGGAGGG - Intergenic
978657891 4:111088255-111088277 GAAAGGGTGAGAGGGGTTGAAGG + Intergenic
979601888 4:122594375-122594397 GAAAGTGTGACATGCGGAGAGGG - Intergenic
982121844 4:152150541-152150563 GAAAGTGGGAGTGGGGTGGAGGG - Intergenic
984412915 4:179418182-179418204 GGAAGTGGGTCAGGCATGGAAGG - Intergenic
985024998 4:185731762-185731784 GAGAGAGAGACAGGCGGGGAGGG - Intronic
985510620 5:311332-311354 GAAAGTTTGACAGGCAGGGACGG + Exonic
985712871 5:1439820-1439842 GCAAGTGTGACCTGCGTGCAGGG + Intronic
988841679 5:35089801-35089823 GAAAATGTAACAGGGTTGGATGG + Intronic
989726118 5:44588668-44588690 GAAAGGGAGACAGGCTGGGAAGG - Intergenic
991441959 5:66660090-66660112 GAAAGTGCTACATGCGTGGCTGG + Intronic
992239336 5:74749965-74749987 GTATGTGTGTGAGGCGTGGAGGG + Intronic
992959632 5:81945967-81945989 GATAGTTTGACAGGCGGGGGGGG + Intergenic
994312997 5:98298355-98298377 GAAAGAGAGACTGGGGTGGAGGG - Intergenic
994776613 5:104042470-104042492 GAAAGGGTGAAAAGGGTGGAAGG + Intergenic
995553831 5:113307196-113307218 GAAATTTTGATAGGCGTGCACGG + Intronic
996480150 5:123966795-123966817 GAAGGAGTGTCAGGCTTGGAAGG + Intergenic
997423403 5:133786673-133786695 GGAAGTGAGACAGGCATTGAGGG + Intergenic
998192825 5:140042153-140042175 CAAAGTGTGCCAGGGGTGGGGGG - Intronic
998624723 5:143833340-143833362 GAAAGTATGACAGAGTTGGAGGG - Intergenic
999305739 5:150518299-150518321 ATAAGTGTGACAGACGGGGATGG - Intronic
999726854 5:154445347-154445369 GAGAGTGGGACTGGCTTGGACGG - Intergenic
1003134888 6:3427483-3427505 GAAAGTGGGCCAGACGAGGATGG + Intronic
1005049165 6:21667380-21667402 GAAAGTGAGAGAGGTGAGGACGG - Intergenic
1005106043 6:22225331-22225353 GAAAGAGTGAAAGGCTTGGGAGG - Intergenic
1008619136 6:53254632-53254654 GAAAGTGTGAATGGGGTGGAGGG - Intergenic
1008626988 6:53326545-53326567 GGAAGTGGGACAGGCGGGTAAGG - Intronic
1011255658 6:85418264-85418286 GAAAGTATGACAACAGTGGAGGG - Intergenic
1012981669 6:105837094-105837116 GACAGTGTGACAGCAGAGGAAGG + Intergenic
1017430496 6:154365822-154365844 GAAAGGGAGACAGGAGAGGAAGG + Intronic
1018228835 6:161656295-161656317 AGAAGTGTGAGAGGCGCGGATGG - Intronic
1021978539 7:26031909-26031931 GAATGACTGACATGCGTGGAGGG + Intergenic
1024281342 7:47722102-47722124 GAAAGTGTCCCAGGTGTGTAAGG - Intronic
1025189606 7:56886614-56886636 GAAAGTGGGACAGGGTTGGGGGG + Intergenic
1025682334 7:63690303-63690325 GAAAGTGGGACAGGGTTGGGGGG - Intergenic
1032839820 7:135704835-135704857 CACAGTGGGACAGACGTGGAAGG - Intronic
1034577789 7:152016107-152016129 AAAAGTCTGACAGGCCTGGCTGG + Intronic
1035112475 7:156494782-156494804 GAAATTGTGAAAAGAGTGGAAGG + Intergenic
1035561229 8:605074-605096 GACAGTGTGACACTTGTGGAGGG - Intergenic
1035700133 8:1632079-1632101 GAAAGAGAGACAGGGGAGGAAGG + Intronic
1035727058 8:1831229-1831251 GACAGTGTGACATCCGTGGAGGG + Intronic
1035727068 8:1831271-1831293 GACAGTGTGACGGCTGTGGAGGG + Intronic
1035727071 8:1831293-1831315 GACAGTGTGACATCCATGGAGGG + Intronic
1035727080 8:1831335-1831357 GACAGTGTGACGGCCATGGAGGG + Intronic
1035727084 8:1831357-1831379 GACAGTGTGACATCCATGGAGGG + Intronic
1035727095 8:1831423-1831445 GACAGTGTGACATCTGTGGAGGG + Intronic
1035727099 8:1831445-1831467 GACAGTGTGACGGCCGTGGAGGG + Intronic
1035727103 8:1831467-1831489 GACAGTGTGACATCCGTGGAGGG + Intronic
1035727108 8:1831489-1831511 GACAGTGTGACGGCCGTGGAGGG + Intronic
1035727112 8:1831511-1831533 GACAGTGTGACATCCGTGGAGGG + Intronic
1035727117 8:1831533-1831555 GACAGTGTGACGGCCGTGGAGGG + Intronic
1035727121 8:1831555-1831577 GACAGTGTGACATCCGTGGAGGG + Intronic
1035727126 8:1831577-1831599 GACAGTGTGACGGCCGTGGAGGG + Intronic
1036051395 8:5202493-5202515 GAAAGTGGAAGAGGCGTGGAAGG + Intergenic
1037475654 8:19254541-19254563 GAAATTGTGAAAGACTTGGAAGG + Intergenic
1038164581 8:25073096-25073118 GAAAGTATGGCAGCCGTGAAGGG - Intergenic
1038605637 8:29000826-29000848 GATAGTGTGACAGGCATGGGAGG + Intronic
1039273303 8:35906859-35906881 GAATGTTTGGCAGGTGTGGAGGG + Intergenic
1041617824 8:59928946-59928968 TACAGTGTCACAGCCGTGGAGGG - Intergenic
1042101765 8:65281947-65281969 GTATTAGTGACAGGCGTGGAAGG - Intergenic
1042121029 8:65488661-65488683 GAAAGGATGACAGCCGTGAATGG + Intergenic
1044801899 8:95965659-95965681 GACAGAGAGACAGGGGTGGAAGG + Intergenic
1045782384 8:105882304-105882326 GAAATTGTGACTATCGTGGAAGG - Intergenic
1045901256 8:107282970-107282992 GCATGTGTGTCAGGCTTGGAGGG - Intronic
1046722900 8:117640764-117640786 GAAAGGGTGACAAGTGGGGAGGG - Intergenic
1047234244 8:123025391-123025413 GAAAGGCTGACAGGCTGGGAGGG - Intronic
1048007422 8:130430794-130430816 CAATGAGTGACAGGCGTGAAGGG + Intronic
1048192347 8:132301362-132301384 GAAGGTATGACAGGCAGGGAGGG - Intronic
1048799429 8:138182423-138182445 GAAAGTGTGGCAGGCGTGGATGG - Intronic
1049391459 8:142373673-142373695 GAAAGTGAGTCAGGCAAGGAAGG + Intronic
1051372064 9:16367167-16367189 GAGAGAGTGATTGGCGTGGATGG - Intergenic
1053751922 9:41266073-41266095 AGCAGTGTGACAGGTGTGGAAGG - Intergenic
1054257445 9:62830403-62830425 AGCAGTGTGACAGGTGTGGAAGG - Intergenic
1054333871 9:63785319-63785341 AGCAGTGTGACAGGTGTGGAAGG + Intergenic
1056129766 9:83572663-83572685 GAAAGTGAGACAGGCATGTGTGG + Intergenic
1060310810 9:122459836-122459858 GAAAGGGTGGGAGGGGTGGAAGG - Intergenic
1061988448 9:134144133-134144155 GACAGTGTGTCAGGCCTGGGCGG + Intronic
1062672790 9:137721401-137721423 GAGAGGGTGAGAGGCGTGGGAGG - Intronic
1062688292 9:137827672-137827694 GCAATTGTGACAGCAGTGGAGGG - Intronic
1187157869 X:16737990-16738012 GAAAGTGTGTCAAGCATGAAGGG + Intronic
1187195483 X:17079458-17079480 GAAAGTGAGACAGGGCAGGAGGG - Intronic
1188521062 X:31038391-31038413 GAAAGAGTGACGGGCTTGGTAGG + Intergenic
1189355107 X:40304563-40304585 AAAATTGTGACAGACGTGGTAGG - Intergenic
1189454742 X:41175842-41175864 GAAACTGTGATAGGCTGGGATGG - Intronic
1189546945 X:42051205-42051227 GTGGGTGTGACATGCGTGGATGG - Intergenic
1191026220 X:55916584-55916606 CAAAGGGTAACAGGCATGGATGG + Intergenic
1192095629 X:68207636-68207658 GATAGTGGGAAAGCCGTGGATGG - Intronic
1197261568 X:124325007-124325029 GGAAGAGTGGCAGGCGGGGAGGG + Intronic