ID: 1084314578

View in Genome Browser
Species Human (GRCh38)
Location 11:68337700-68337722
Sequence GAGGTAGACCTGACTATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084314578 Original CRISPR GAGGTAGACCTGACTATGGG TGG (reversed) Intronic
902203414 1:14850826-14850848 GAGGTACACCTGCCTAGGGGAGG - Intronic
903422744 1:23230404-23230426 GAGGTCCACCTGAGTCTGGGAGG - Intergenic
909290558 1:73878052-73878074 CAGGCAGAGCTGACTATGGAAGG + Intergenic
912107570 1:106299024-106299046 GAGGTTGAAATGAGTATGGGGGG + Intergenic
913274013 1:117120882-117120904 CAGGTGGACCTGCCCATGGGTGG - Exonic
913316798 1:117560586-117560608 GAGGTAGAATTGACTAGGAGGGG + Intergenic
916713936 1:167434588-167434610 GAGGTTGACCTTCCTATAGGGGG + Intronic
918461913 1:184785263-184785285 GAGGTAGAGCGGAGAATGGGAGG + Intergenic
919117773 1:193302482-193302504 TAGGAAGAGCTGACTATGGAAGG + Intergenic
923447865 1:234089307-234089329 GAGGTAGAACTCACTGTGGAAGG + Intronic
1063652457 10:7951589-7951611 GAGGTGGACATGATTTTGGGTGG - Intronic
1063688198 10:8258477-8258499 GAGTTAGCCCTGAGGATGGGAGG - Intergenic
1065193716 10:23240099-23240121 GAGGTTCACCTGAGTCTGGGAGG + Intergenic
1074523307 10:114244052-114244074 GAGGCATACCTGAGAATGGGTGG + Intronic
1075920873 10:126211600-126211622 GAGGTAGAGATGACTACTGGAGG - Intronic
1076912425 10:133397964-133397986 GAGGTAGACTTGCCCCTGGGTGG + Intronic
1077900642 11:6484951-6484973 GAGGAAGACCAGATTATGGAAGG - Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083352762 11:62042674-62042696 GAAGTAGAACTGACTGTTGGAGG + Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1084314586 11:68337743-68337765 GAGGAAGATCTGGCTGTGGGTGG - Intronic
1085588594 11:77735125-77735147 GAGGGAGGGCTGGCTATGGGCGG + Intronic
1086596593 11:88579463-88579485 GAGGTAGAACTGGATATGAGGGG + Intronic
1090074486 11:123571449-123571471 CAGCTAGACCTAACTATAGGAGG + Intronic
1091652829 12:2322616-2322638 GAGGAACACCTGACTTTGGGAGG - Intronic
1100064562 12:90626295-90626317 GAGGAATACCAGACTATGGGAGG + Intergenic
1100183767 12:92114323-92114345 GAGGTAGATCTGGCTGGGGGAGG - Intronic
1100375841 12:94015525-94015547 GAGGATCACCTGACTCTGGGAGG - Intergenic
1109705880 13:66092327-66092349 CTGGTAGACATGACTATGGCTGG + Intergenic
1112951370 13:105001155-105001177 GAGACACACCTGACTGTGGGAGG - Intergenic
1114510505 14:23256052-23256074 GAGCCAGACTGGACTATGGGAGG - Intronic
1116018817 14:39437294-39437316 GGAGTAGGCCTGACAATGGGAGG - Intergenic
1118079984 14:62347550-62347572 GATGTAGAGCTGATTCTGGGCGG + Intergenic
1118553764 14:66989018-66989040 GAGATACACATGACTATGTGTGG - Intronic
1119128433 14:72150034-72150056 CAGGTAGACGTGAATTTGGGAGG - Intronic
1120230341 14:81834913-81834935 GAGGATCACCTGACTTTGGGAGG - Intergenic
1122117352 14:99534560-99534582 GAGGCAGTCCTGCCTCTGGGTGG - Intronic
1127358392 15:58223743-58223765 TAGGCAGACCTGAGTATGAGGGG - Intronic
1128391976 15:67188461-67188483 CAGGTAGACCTGACTATATCAGG - Intronic
1132032048 15:98446296-98446318 GAGGTGGACCTGTCCATGGTAGG - Intronic
1134246917 16:12547067-12547089 GAGGCAGACATGCCTATGTGAGG + Intronic
1137711248 16:50568337-50568359 GTGGTAGGCCAGCCTATGGGGGG + Intronic
1138375542 16:56561289-56561311 GAGGCAGACAAGACTGTGGGAGG + Intergenic
1139441153 16:66967937-66967959 GAGGGAGACCTGACTATACACGG - Intronic
1144654289 17:17025407-17025429 GAGGTAGACCTGAGGGAGGGAGG + Intergenic
1144667421 17:17111551-17111573 GAGGGAGACCTGGCAACGGGTGG + Intronic
1146915156 17:36673609-36673631 GAGGTGGACTTGACCCTGGGAGG + Intergenic
1150413242 17:64964638-64964660 GAGGACCACTTGACTATGGGAGG + Intergenic
1151560083 17:74865330-74865352 GAAGTAGACAGGTCTATGGGAGG + Intronic
1151682461 17:75629248-75629270 GAGGCAGCGCTCACTATGGGGGG - Exonic
1152261352 17:79268966-79268988 TAGGTAGACATGAATTTGGGGGG - Intronic
1153582919 18:6593652-6593674 GAGGTACACATGACTGGGGGAGG - Intergenic
1155586537 18:27372773-27372795 GATGGAGACCTGACTATCAGTGG + Intergenic
1155862771 18:30924559-30924581 GAGATTGATCTGACTATGGTGGG - Intergenic
1158920443 18:62186576-62186598 GAGGTGGTCCTGCCTGTGGGTGG - Intronic
1159321550 18:66857215-66857237 GAGGCAGAACTGAATCTGGGAGG + Intergenic
1159724142 18:71932567-71932589 GAGGTACATCTGATTTTGGGGGG - Intergenic
1162498665 19:11038375-11038397 CAGGTAGACATGAGTCTGGGGGG + Intronic
1165753264 19:38274839-38274861 GAGGTAGACCAGCTTACGGGAGG + Intronic
1166052928 19:40271335-40271357 GAGGTTGACCTGAGCCTGGGAGG + Intronic
929910514 2:46085605-46085627 GAGGAAGACCTGAGTCAGGGAGG - Intronic
931331146 2:61285395-61285417 GAGGAACACCTGAGTCTGGGAGG + Intronic
944545886 2:200798473-200798495 CAGGTAGACATGAATTTGGGGGG + Intergenic
1169619230 20:7486538-7486560 GAGGTACACCTGACTCTAAGAGG - Intergenic
1178893100 21:36536310-36536332 GAGGGAGAACTGAGGATGGGTGG - Intronic
1180910452 22:19446715-19446737 GAGGGAGACCTGTCTCAGGGGGG - Intronic
1183274687 22:36886329-36886351 GAGGTAGACAGGACTATGTGTGG - Intergenic
949682281 3:6527954-6527976 CAGCTAGACCTGACTGTGGATGG + Intergenic
950557020 3:13702175-13702197 GAAGTAGCCCAGGCTATGGGTGG - Intergenic
952533459 3:34286245-34286267 GAGGAAGACCTGACAAGGAGTGG + Intergenic
955420394 3:58730647-58730669 GAGGTAGGGGTGACTATGGCTGG + Intronic
956934268 3:74082085-74082107 TAGGTTGAGCTAACTATGGGAGG - Intergenic
957790742 3:84937646-84937668 GAGGTAATCATGACTAGGGGAGG + Intergenic
958535499 3:95398147-95398169 GAGGTAGCCCAGACAAGGGGAGG + Intergenic
964496240 3:157293344-157293366 GAGGTACACATGACTATATGAGG + Intronic
966862016 3:184235878-184235900 GAGGTATACATGACTGTGTGTGG - Intronic
966862024 3:184235936-184235958 GAGGTACACATGACTGTGTGTGG - Intronic
975201054 4:71590149-71590171 GAGGTAGTCCTGTCTATCTGGGG - Intergenic
988875269 5:35438426-35438448 GAGGGAAATGTGACTATGGGAGG - Intergenic
991164421 5:63547003-63547025 GAGGATGACTGGACTATGGGAGG - Intergenic
998390803 5:141785944-141785966 CAGGTACACCTGACTGTGGTTGG - Intergenic
999072379 5:148759469-148759491 AAGGTATTCTTGACTATGGGTGG + Intergenic
1004504382 6:16236155-16236177 TAGGTTGAACTAACTATGGGAGG - Intergenic
1006300845 6:33192853-33192875 TATGGAGACCTGATTATGGGTGG - Intergenic
1010255016 6:73747816-73747838 GATGAAGGCCTGAATATGGGTGG - Intronic
1012846289 6:104393605-104393627 GAGGTGTGGCTGACTATGGGAGG + Intergenic
1014871660 6:126603644-126603666 CTGGTAGACTTGGCTATGGGGGG + Intergenic
1015407284 6:132852065-132852087 GAGGATCACCTGACTAGGGGAGG + Intergenic
1021590472 7:22255501-22255523 GAGGATCACCTGACTCTGGGAGG + Intronic
1022498984 7:30870950-30870972 GAGGCACACTTGACTCTGGGAGG - Intronic
1028809548 7:95068659-95068681 GTGGTAGACATGACTAGGGAAGG - Intronic
1031313247 7:120226238-120226260 GAGCTAGAACTCCCTATGGGAGG - Intergenic
1031598059 7:123670513-123670535 GAGCTAGAGCTGCCTTTGGGAGG - Intergenic
1033057338 7:138070246-138070268 CAGATAGACCTGACTTTGGGGGG + Intronic
1036451142 8:8868786-8868808 GAAGTAGCGATGACTATGGGTGG - Intronic
1038410356 8:27353763-27353785 CACTTAGACCTGACTATGGGTGG + Intronic
1039381132 8:37086418-37086440 CAGGTAGACCTGTACATGGGAGG - Intergenic
1043728478 8:83644282-83644304 GAGGTAGTGCTGCCTTTGGGAGG + Intergenic
1045320075 8:101075656-101075678 GAGGGAAACCTAACTGTGGGTGG - Intergenic
1046489795 8:114936591-114936613 GAGGAAGATGTGACTATGGGAGG + Intergenic
1057222021 9:93262583-93262605 GAGGGAGAGCTGACTATGCGTGG + Intronic
1060458744 9:123827423-123827445 GAGGAACACCTGACCCTGGGAGG + Intronic
1060903109 9:127279053-127279075 CAGGTGGACCTGAATTTGGGGGG + Intronic
1185650708 X:1645967-1645989 GTGGTAGACATGGCTATGGTGGG + Intergenic
1195297035 X:103489404-103489426 GAGGTGGAACTGAGTCTGGGTGG - Intergenic
1196283360 X:113850416-113850438 CAGGGAGACCTGACTTTGGATGG - Intergenic
1197599418 X:128510192-128510214 GAGAAAGACATGAATATGGGGGG + Intergenic
1199849968 X:151718708-151718730 GAGGTAGACCTGACTGTTTTAGG + Intronic