ID: 1084314586

View in Genome Browser
Species Human (GRCh38)
Location 11:68337743-68337765
Sequence GAGGAAGATCTGGCTGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 584
Summary {0: 1, 1: 1, 2: 5, 3: 54, 4: 523}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084314586_1084314595 12 Left 1084314586 11:68337743-68337765 CCACCCACAGCCAGATCTTCCTC 0: 1
1: 1
2: 5
3: 54
4: 523
Right 1084314595 11:68337778-68337800 TGCCTGGTCCACCAACAGCCAGG 0: 1
1: 0
2: 3
3: 31
4: 162
1084314586_1084314591 -4 Left 1084314586 11:68337743-68337765 CCACCCACAGCCAGATCTTCCTC 0: 1
1: 1
2: 5
3: 54
4: 523
Right 1084314591 11:68337762-68337784 CCTCCTCCAAGAAGCCTGCCTGG 0: 1
1: 12
2: 100
3: 317
4: 802

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084314586 Original CRISPR GAGGAAGATCTGGCTGTGGG TGG (reversed) Intronic
900393958 1:2445535-2445557 CTGGCAGAGCTGGCTGTGGGTGG + Intronic
901028194 1:6290375-6290397 GTGGCAGATCAGCCTGTGGGAGG + Intronic
902645668 1:17796231-17796253 GAGGAAGAGGTGGTTTTGGGTGG + Intronic
903518478 1:23929035-23929057 GAGGAAGAGCAGGAAGTGGGAGG - Intergenic
903593984 1:24479962-24479984 GTGGTAGATTTGGCTGTGGACGG + Intergenic
903658252 1:24961851-24961873 GAGGAAGAGGAGGCAGTGGGGGG + Intronic
905331796 1:37208174-37208196 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
905626813 1:39494891-39494913 GTGGAAGCCCAGGCTGTGGGTGG + Intronic
905670129 1:39785928-39785950 GTGGAAGCCCAGGCTGTGGGTGG - Intronic
905839003 1:41157609-41157631 GAGAAAGGTCTGGATTTGGGAGG + Intronic
906065864 1:42979749-42979771 GAGGCAGATCTGGCTGGGTGTGG - Intergenic
906259558 1:44376606-44376628 GATGAAGACCTGGCTGGGTGCGG - Intergenic
907353539 1:53853363-53853385 GAGGAGGATCTGGTTGTAGTGGG + Intronic
907398488 1:54209211-54209233 CAGGAAGATCTGGATGGGGCAGG + Intronic
910460231 1:87441420-87441442 CAGGTGGATCTGGCTGTTGGTGG + Intergenic
911638939 1:100266622-100266644 GAGGTAAATCTGGCTGGAGGGGG + Exonic
912654361 1:111472365-111472387 GAGGGAGAAAGGGCTGTGGGAGG - Intergenic
913055855 1:115158983-115159005 GAGGAAAATCTGGCAGAGAGTGG + Intergenic
913552730 1:119932295-119932317 GAGGAAGTTCAGGCTGGGTGTGG + Intronic
914317464 1:146527687-146527709 GAGGTGGATCTGCCTGTTGGTGG + Intergenic
914496892 1:148205673-148205695 GAGGTGGATCTGCCTGTTGGTGG - Intergenic
914694967 1:150068938-150068960 AAGGAAGAACTGGCTGTAAGGGG - Intronic
914810910 1:151027332-151027354 GAGCAAGTTGTGGCTGTGGGTGG + Intronic
915743472 1:158138166-158138188 GAGGAAGAGATGGGTATGGGGGG - Intergenic
916380355 1:164203427-164203449 GAAGAAAATCTGCCTGTGGGTGG - Intergenic
917383120 1:174436838-174436860 GAGGAGTACCTGGCTGTGTGAGG - Intronic
917710202 1:177677172-177677194 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
918826436 1:189330657-189330679 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
920264378 1:204710876-204710898 GACTGAGATCTGGCTCTGGGTGG + Intergenic
920371303 1:205481076-205481098 GAGGAAGATGGGGCTGGGGGAGG - Intergenic
921777542 1:219119258-219119280 GATGAAAATCTGGCGGTGGGGGG - Intergenic
922856340 1:228778215-228778237 GAGGAAGTACAGGCAGTGGGTGG + Intergenic
923619525 1:235566722-235566744 GCTGAAGATCTGGGTGTGAGTGG + Intronic
923625021 1:235606760-235606782 GGGGAAGTCCTGGCTGTGGGAGG + Intronic
923786645 1:237074428-237074450 GAGGAAGATGCGGCAATGGGAGG + Intronic
924561248 1:245157201-245157223 GAGGAAGATCCGGAGGCGGGTGG + Intronic
924587659 1:245374289-245374311 GAGGAAGGTGAGGCTCTGGGAGG + Intronic
1062832668 10:616576-616598 GAGGAAGCCCTGGCTGGGCGAGG - Intronic
1063142005 10:3263930-3263952 CAGGAAGATCAGGCTGCAGGGGG + Intergenic
1064141263 10:12792526-12792548 GAGAAAGTTCTGGCAGTGTGTGG + Intronic
1064289719 10:14022660-14022682 GGAGAAGTGCTGGCTGTGGGAGG + Intronic
1064578555 10:16770335-16770357 GAAGAGGACCTGGCTGTCGGTGG - Intronic
1065175316 10:23069849-23069871 GAGGAAGAACTGGCCATGGTTGG + Intergenic
1066672322 10:37853446-37853468 GAGGAAGAGCTTGCAGTGAGCGG - Intronic
1066674500 10:37874178-37874200 GAGGAAGAGCTTGCAGTGAGCGG - Intergenic
1068416047 10:56724134-56724156 GAGGAAGCTCTGGCCGGGCGCGG - Intergenic
1068860783 10:61845830-61845852 CAGGATGATCTGGCTGAGGCAGG + Intergenic
1069791651 10:71026513-71026535 GAAGCAGATCTGGCTGTGGAGGG - Intergenic
1071784260 10:88880904-88880926 CAGGAAGACCTGGCTGCTGGTGG + Intronic
1072432304 10:95384006-95384028 GAGGAAGAGCGGGCTGGGAGGGG + Exonic
1072531979 10:96328221-96328243 GAGGTAGAGGAGGCTGTGGGAGG - Intronic
1072681646 10:97511902-97511924 GAGGAAACTGAGGCTGTGGGGGG + Intronic
1072733830 10:97865952-97865974 TAGGAAGATCTGTCTCTGTGTGG - Exonic
1072881711 10:99234845-99234867 GAGGAGGAACTGGCGGGGGGAGG + Intronic
1073117434 10:101099482-101099504 GAGGAGGGTCTGGATGAGGGTGG + Intronic
1073508426 10:104023994-104024016 AAGGAACATCTGGCAGTGAGTGG - Intronic
1074329821 10:112494802-112494824 AAGAAAGATCTGGCTGGGTGCGG - Intronic
1074453860 10:113580771-113580793 GAGGAAGAACAGGGTGAGGGAGG - Intronic
1074502204 10:114036591-114036613 GAGGCAGAGCTTGCAGTGGGTGG - Intergenic
1075344698 10:121673534-121673556 GAGCAACATCTGTCTCTGGGCGG - Intergenic
1075794903 10:125112961-125112983 GAGCAGGAGCTGGCTGTCGGAGG - Intronic
1075850505 10:125582355-125582377 GAGGAAGTTCAGGCTCTGGAAGG + Intronic
1076520324 10:131077106-131077128 GAGGCAGGACTGGCTGTGGCAGG + Intergenic
1076525764 10:131111657-131111679 GGGGAAGGTCAGGCTGTGCGAGG - Intronic
1076705804 10:132300979-132301001 GAGGAAAATCTGGCTGGGAAGGG + Intronic
1077041212 11:524339-524361 AAGGAAGATCTGGCCGGGCGCGG + Intergenic
1077331256 11:1984701-1984723 GAGGAAAACCAGCCTGTGGGGGG + Intergenic
1077336973 11:2009768-2009790 GGGGAGGGTCTGGCTCTGGGAGG - Intergenic
1077670547 11:4153411-4153433 GATGAAGATCTGACTGTGCCTGG + Intergenic
1078466755 11:11555727-11555749 GAGGAGGTTCTGGCTGAGGGAGG - Intronic
1079031423 11:16989017-16989039 GAGGAAGATGTGGCTATTTGGGG - Intronic
1079202047 11:18384716-18384738 GAGGGAGCTCAGGCTGTGGGGGG - Intergenic
1079279755 11:19076610-19076632 GCTGAAGAACTGGCTGTGGGAGG + Intergenic
1079793326 11:24767005-24767027 GAGGCTGATGTGGGTGTGGGTGG - Intronic
1080002312 11:27363370-27363392 GAGGAAGGGCTGGCTAAGGGAGG - Exonic
1080059288 11:27939829-27939851 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1080843118 11:36003156-36003178 GAGGGTGATCTGGCTGTGACAGG + Intronic
1081669556 11:44935451-44935473 GATGAAAACCTGTCTGTGGGGGG - Intronic
1082956571 11:58876661-58876683 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1082986913 11:59177037-59177059 GAGGAAGAGCTGGTTTTGGAGGG - Intronic
1083485500 11:62981002-62981024 GAGGAAGAGGTGGCGGAGGGTGG + Exonic
1083498235 11:63078326-63078348 GAGGACTACCTGGCTGTGTGAGG + Intergenic
1083611684 11:64007415-64007437 GAGAAAGAACTGGCTTTGGAAGG + Intronic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1084314586 11:68337743-68337765 GAGGAAGATCTGGCTGTGGGTGG - Intronic
1084314607 11:68337845-68337867 GGGGAAGATCTGGCTGTGGGTGG - Intronic
1084314619 11:68337888-68337910 GAAGAAGACCTGGCTGTAGGTGG - Intronic
1084960504 11:72713774-72713796 GAGGCAGAGCTTGCAGTGGGCGG + Intronic
1085017676 11:73185894-73185916 GAGCAAGATCGGGTTGTGGATGG + Intergenic
1085342232 11:75740144-75740166 GAGAAAGAGCTGGGTGTGGAGGG + Intergenic
1085401960 11:76240863-76240885 GAGGGAGATGTGGCTGGGGTGGG + Intergenic
1085465888 11:76723030-76723052 GAGGAAACTGTGGCTCTGGGTGG + Intergenic
1085588594 11:77735125-77735147 GAGGGAGGGCTGGCTATGGGCGG + Intronic
1085810642 11:79677948-79677970 CAGGAAGATCTGGATGTGAGGGG - Intergenic
1086175353 11:83884716-83884738 GAGGAGTATCTGGCTGTGTGAGG - Intronic
1086544467 11:87951769-87951791 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1088171213 11:106999073-106999095 GAGGAACATGGGGTTGTGGGTGG - Intronic
1088805862 11:113351509-113351531 GAGGAAAAGCTGGATATGGGTGG + Intronic
1089523513 11:119081543-119081565 GAGGTCAGTCTGGCTGTGGGAGG - Exonic
1089678614 11:120107142-120107164 GATTCAGATCTGGCTGTGGAAGG - Intergenic
1089790574 11:120940347-120940369 AAAGCAGATCTGGCTGTGGCAGG + Exonic
1090126955 11:124096464-124096486 GAGGTAGAACTGGCTGATGGCGG - Intergenic
1090314798 11:125776736-125776758 GAGAAATAACTTGCTGTGGGTGG - Exonic
1091225749 11:133955914-133955936 GAGGCAGAGCTGGCTGGGGGCGG - Intronic
1091309654 11:134563317-134563339 GAAGGAGAGCTGGCTCTGGGTGG + Intergenic
1202814237 11_KI270721v1_random:39877-39899 GAGGAAAACCAGCCTGTGGGGGG + Intergenic
1202819957 11_KI270721v1_random:64950-64972 GGGGAGGGTCTGGCTCTGGGAGG - Intergenic
1091652829 12:2322616-2322638 GAGGAACACCTGACTTTGGGAGG - Intronic
1091908994 12:4213506-4213528 GAGGAAGATGGGGCTATAGGAGG + Intergenic
1092285910 12:7129228-7129250 GAGGCTGGTCTGGCTGTGTGAGG + Intergenic
1092772488 12:11909910-11909932 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1094441716 12:30485440-30485462 GCGGAAGTTGTGGCTGTGGCAGG - Intergenic
1095428973 12:42111906-42111928 GAGGAGTACCTGGCTGTGTGAGG - Intronic
1095483360 12:42658740-42658762 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1095567752 12:43646410-43646432 AAGGAAACTCTGGCTGAGGGAGG - Intergenic
1095816264 12:46426299-46426321 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1095873715 12:47057480-47057502 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1096926774 12:55156817-55156839 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1096962977 12:55598832-55598854 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1097153274 12:56994917-56994939 GAGGGGGAACTGGCTGGGGGTGG + Intronic
1097625394 12:61993983-61994005 GAGCAGGATCTGGTTGTGAGAGG - Intronic
1099512399 12:83554487-83554509 GAGGAGGACCTGGCTGTGTGAGG + Intergenic
1099547197 12:83999011-83999033 TAGGAAAACCTGGCTGTGAGCGG + Intergenic
1100183767 12:92114323-92114345 GAGGTAGATCTGGCTGGGGGAGG - Intronic
1102590073 12:113950315-113950337 GAGGGAAATTTGGCTGTGGGTGG - Intronic
1103250046 12:119491807-119491829 GAGGAAAATGTTGCTGTTGGTGG - Intronic
1103363847 12:120368861-120368883 GATGAACATCTTGCTGCGGGAGG + Exonic
1103716050 12:122945987-122946009 CAGGCAGCTCTGGCTGTGGAGGG - Intronic
1103763331 12:123266336-123266358 GAAGAAGCGGTGGCTGTGGGAGG - Intronic
1104472618 12:129042917-129042939 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1104999020 12:132676716-132676738 GAGGTAGAGCAGGCTGGGGGTGG - Intronic
1105223850 13:18409102-18409124 GAGGAGGAGGAGGCTGTGGGAGG + Intergenic
1105298606 13:19113436-19113458 AAGGCGGCTCTGGCTGTGGGAGG - Intergenic
1105603971 13:21911608-21911630 GTGAAAGAACTGGCTGGGGGAGG - Intergenic
1106177329 13:27342520-27342542 GAGGGAGGTCTGCATGTGGGTGG - Intergenic
1106475439 13:30094320-30094342 GACGAACACCTGGCTGAGGGAGG - Intergenic
1106481517 13:30140562-30140584 GAGGAGGATGCAGCTGTGGGAGG - Intergenic
1109320568 13:60805247-60805269 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1109442817 13:62397622-62397644 GAGGAAGCCCAGGCTGTGGCTGG + Intergenic
1110852598 13:80262528-80262550 GGGGAGGAACTGGCAGTGGGAGG + Intergenic
1112087024 13:96041987-96042009 GGGGAGGATCAGGCAGTGGGTGG - Intronic
1112379434 13:98874604-98874626 GATGAAGATCTGGCATTGGGAGG - Intronic
1113058535 13:106296259-106296281 AAGGAAGACTGGGCTGTGGGAGG - Intergenic
1114007998 14:18333928-18333950 GAGGAGGAGGCGGCTGTGGGAGG + Intergenic
1114052205 14:18930040-18930062 AGGAAAGCTCTGGCTGTGGGAGG + Intergenic
1114054208 14:18952633-18952655 AGGAAAGCTCTGGCTGTGGGAGG + Intergenic
1114108348 14:19449299-19449321 AGGAAAGCTCTGGCTGTGGGAGG - Intergenic
1114110354 14:19471884-19471906 AGGAAAGCTCTGGCTGTGGGAGG - Intergenic
1114695650 14:24624714-24624736 GAGGAAGCTCTTCCTGTGGGAGG + Intergenic
1116292045 14:43056582-43056604 GAGGAAGGGATGGGTGTGGGTGG - Intergenic
1116911762 14:50474298-50474320 GAGGATCATCTGGCTCTGGGAGG + Intronic
1117062476 14:51977316-51977338 CAGGAAGATCGGGCTGAGGCGGG + Intronic
1117104606 14:52384931-52384953 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1117237771 14:53796881-53796903 GAGGAGGAGCTGGCTGTGAAAGG - Intergenic
1117495299 14:56296427-56296449 GAGGAAGATGAGGCTCGGGGAGG + Intronic
1117751543 14:58929251-58929273 GAGGCAGAGCTTGCTGTGAGCGG + Intergenic
1118067089 14:62204479-62204501 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1119009310 14:70967922-70967944 TTGGAGGATCTGGCTCTGGGGGG + Intronic
1120193215 14:81458435-81458457 GAGGTAGAGGTTGCTGTGGGCGG + Intergenic
1121233838 14:92377953-92377975 GATGAAGGTCTGGGGGTGGGAGG + Intronic
1121788287 14:96679673-96679695 TGGGAAGATCTGGCTGGAGGAGG + Intergenic
1122244604 14:100393591-100393613 GTGGAAGGTGTGTCTGTGGGGGG + Intronic
1122785768 14:104162687-104162709 GTGGAGGAGCTGGCTCTGGGTGG + Intronic
1122946096 14:105010493-105010515 TAGGAAGATGTGGCTGTGTGCGG + Exonic
1125055223 15:35352008-35352030 AAGCAATATCTGGCTGTGTGAGG - Intronic
1125058517 15:35391214-35391236 GAGGAGTACCTGGCTGTGCGAGG + Intronic
1126309919 15:47303920-47303942 GAGGCAGATCTGGGAGAGGGTGG - Intronic
1126357359 15:47810807-47810829 GAGGACTATCTGCCTGTGGTGGG - Intergenic
1127430899 15:58907167-58907189 GAGGTGAATCTGGCTGTGAGAGG + Intronic
1127489448 15:59448304-59448326 GAGGTAGATGTTGCAGTGGGTGG + Intronic
1128925924 15:71655883-71655905 GAAGAAGATCTGGATGGTGGTGG + Intronic
1129562740 15:76589244-76589266 AGGGAGGATCTGGCGGTGGGTGG + Intronic
1130646989 15:85737208-85737230 GAAGAAGATATGGCTGGGCGCGG - Intronic
1130922323 15:88357826-88357848 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1131729863 15:95268171-95268193 GAGGAGGATCTAGCTAAGGGAGG - Intergenic
1131828551 15:96339810-96339832 GATGAAGTACTGGCGGTGGGGGG - Exonic
1132270677 15:100521325-100521347 AAGGAAGAGCTGGCTGTGCTGGG - Intronic
1132411271 15:101579787-101579809 GAGGAAGAACTGGGAGTCGGGGG + Intergenic
1132732125 16:1367679-1367701 GAGGAAGATCCGGCAGTGGGAGG - Intronic
1132837928 16:1963959-1963981 GATGAAGTTCAGGTTGTGGGAGG - Intronic
1134040235 16:11062874-11062896 GAGAAAGAGCTTGCTTTGGGGGG + Intronic
1134635165 16:15786361-15786383 GAGGAAGATCTCGCTATGGAAGG + Intronic
1134765032 16:16750406-16750428 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1134981021 16:18608805-18608827 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1136183824 16:28573256-28573278 GAGGAGGAGCTGGAGGTGGGTGG + Intronic
1136606643 16:31338638-31338660 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1136624574 16:31454177-31454199 GAGGCAGAGCTTGCAGTGGGCGG - Intergenic
1137728161 16:50670732-50670754 CAGGAGGAGCTGGCTGTGGCAGG + Intronic
1139961032 16:70717322-70717344 GAGGAAGAGCCAGCTGTGGCGGG + Intronic
1140287605 16:73619415-73619437 GAGGCAGAGCTGGCAGTGAGCGG + Intergenic
1140344239 16:74196592-74196614 GAAGAAGATCAGGCTGGGGGCGG - Intergenic
1140503765 16:75456854-75456876 GGGGATGAGCTGGCGGTGGGTGG - Intronic
1140511060 16:75508826-75508848 GGGGATGAGCTGGCGGTGGGTGG - Intergenic
1141362292 16:83406754-83406776 GAGGCAGAGCTGGCTGGGTGTGG - Intronic
1143189589 17:5031843-5031865 GAGGAAGGTCCGGAGGTGGGCGG + Intergenic
1143658986 17:8313205-8313227 GATCAAGATCTGGCTGTGGGGGG - Exonic
1144547889 17:16215103-16215125 GAGGAAGAATGGGCTGTGGCCGG - Intronic
1144567785 17:16374301-16374323 GAGCAAGTTCTGGGTGTGAGAGG - Intergenic
1145034717 17:19533196-19533218 GAGGAAGCTGAGGCTCTGGGAGG + Intronic
1145731231 17:27188298-27188320 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1145996713 17:29109056-29109078 GAAGGGGACCTGGCTGTGGGTGG + Intronic
1146391070 17:32423626-32423648 AAGAATGATCTGGCTGAGGGCGG - Intergenic
1146739998 17:35275124-35275146 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1147843552 17:43389297-43389319 GGGGAAGATCGGGCTCGGGGTGG + Intergenic
1148850137 17:50550628-50550650 CAGGCAGGCCTGGCTGTGGGAGG + Intronic
1149316054 17:55439930-55439952 GAGGCAGATCTTGCAGTGAGTGG - Intergenic
1149344713 17:55723119-55723141 GAGGAAGATCTGGAGGTCGGCGG - Intronic
1149808717 17:59644839-59644861 TAGGAAGAGCTGGCTGGGCGTGG - Intronic
1150140446 17:62724083-62724105 AAATAGGATCTGGCTGTGGGGGG + Intronic
1151833524 17:76569377-76569399 GAGGGAGATTTGGAGGTGGGTGG + Intronic
1152282113 17:79390931-79390953 GAAGCAGAGCTGGCTTTGGGTGG - Intronic
1152343578 17:79738323-79738345 GAGGGAGTTCTGGCTTTTGGGGG - Intronic
1152613244 17:81325923-81325945 TAGGCAGAGCTGGCTGTGGTCGG - Intronic
1152752946 17:82074063-82074085 GATCAAGATTTGGCTGGGGGCGG + Intergenic
1152775091 17:82196180-82196202 GAGGAGGATCCAGCTGTGGGTGG - Intronic
1152793820 17:82296928-82296950 GAGGAAGAGGAGGCTGAGGGGGG - Intergenic
1153394767 18:4606329-4606351 GAGGAGGATAGGGCTGTAGGTGG + Intergenic
1154320604 18:13348444-13348466 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1154475277 18:14748672-14748694 GAGGAGGAGGCGGCTGTGGGAGG + Intronic
1154529455 18:15330012-15330034 GAGGAGGAGGAGGCTGTGGGAGG - Intergenic
1155976642 18:32139141-32139163 GAGGCAGAGCTTGCTGTGAGCGG - Intronic
1156206889 18:34895535-34895557 GAGGAATACCTGGCCGTGTGAGG - Intergenic
1157474288 18:48011494-48011516 GGGGAAGAGCTGGCTCAGGGAGG + Intergenic
1158054261 18:53260575-53260597 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1159454010 18:68638435-68638457 AGGGAAGATCAGGCAGTGGGAGG + Intergenic
1159783449 18:72686614-72686636 GAGGAAGAGCTTGCAGTGAGTGG - Intergenic
1160002962 18:75045045-75045067 GGGAAAAATCTGGGTGTGGGGGG + Intronic
1160505021 18:79422312-79422334 CAGGAAGTTTTGGCAGTGGGGGG - Intronic
1161063374 19:2226315-2226337 CAGGGAGTTCTGGCTGAGGGCGG - Exonic
1161793424 19:6373789-6373811 GCTGAAACTCTGGCTGTGGGAGG + Intronic
1162289461 19:9768250-9768272 GGAGATGATCTGGCTGTGGGAGG - Intronic
1162851085 19:13431420-13431442 GAGGAAGATCTGGAGGTCTGAGG + Intronic
1163287480 19:16357623-16357645 GAGGCAGATGTGGCAGTGAGGGG + Intronic
1163297419 19:16421282-16421304 GTGGCAGTTGTGGCTGTGGGTGG - Intronic
1163936979 19:20455608-20455630 GAGGAACATCTGAGTTTGGGAGG - Intergenic
1164367537 19:27602334-27602356 GAGGAGTATCCGGCTGTGTGTGG + Intergenic
1164486995 19:28666990-28667012 GAGTGAGATCTGGCTGTAGGAGG - Intergenic
1164534725 19:29076572-29076594 GGTGAAGCTCTGGCTCTGGGTGG - Intergenic
1164580732 19:29433421-29433443 CAGGAAGGACTGGCTCTGGGTGG - Intergenic
1164839244 19:31380258-31380280 GAAGCAGATGTGGCTGCGGGAGG + Intergenic
1165213091 19:34251102-34251124 GAGGAAGATCTGGTTGAAAGTGG - Intergenic
1166133268 19:40759635-40759657 GAGGAAGGTCTGGCAGTGGGAGG - Intronic
1167152153 19:47716548-47716570 GATGGAGAGCTGCCTGTGGGAGG - Exonic
1167459360 19:49616113-49616135 GAGGAAGAAATGGCTGAAGGAGG + Exonic
1168147641 19:54428955-54428977 GAGGCTGATCAGGCTGTGGGTGG + Intronic
924978861 2:202033-202055 GAGGAAGATGTTGCTGGAGGCGG - Intergenic
925344346 2:3159989-3160011 GAGACAGACATGGCTGTGGGGGG - Intergenic
927239708 2:20910839-20910861 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
927332851 2:21886473-21886495 GTGGAAGATATGTCTGTGGCGGG - Intergenic
928137812 2:28701513-28701535 GAGGAAGAGCTTGCAGTGAGTGG + Intergenic
928463426 2:31497064-31497086 GAGGAGGACCTGGCCGTGTGAGG - Intergenic
928907170 2:36380652-36380674 GGGGAAGATTTTGCTTTGGGAGG + Intronic
929964626 2:46524965-46524987 CAGGAAGATCAGCCTGGGGGTGG + Intronic
930542050 2:52718854-52718876 GAGGTAGAGAAGGCTGTGGGCGG + Intergenic
930818105 2:55619501-55619523 GGGGAAGATGTGGTTATGGGGGG - Intergenic
930922742 2:56777220-56777242 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
931179012 2:59881312-59881334 GAGGAAGATGGGGGTGAGGGAGG - Intergenic
931638754 2:64363146-64363168 GTGGAAGTTCTGACAGTGGGAGG - Intergenic
931818587 2:65929559-65929581 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
932750854 2:74370828-74370850 GAGGAAGAAGTGGAGGTGGGAGG + Intronic
933002525 2:76943363-76943385 GAGGCAGAGCTTGCAGTGGGCGG + Intronic
933203612 2:79479630-79479652 GAGGAATACCTGGCTGGGTGTGG + Intronic
934018764 2:87921459-87921481 GAGGAGTATCTGGCAGAGGGAGG + Intergenic
934785738 2:97004382-97004404 GAGGCAGATCTTGCAGTGAGCGG - Intronic
934997500 2:98978575-98978597 GAGGAGTACCTGGCTGTGGGAGG - Intergenic
935102152 2:100007038-100007060 GAGGAAGATAAGGATGAGGGGGG + Intronic
935223479 2:101034523-101034545 GCTGTAGCTCTGGCTGTGGGTGG - Intronic
936480330 2:112879713-112879735 GAGGCTGATCTGGCTCTGTGAGG + Intergenic
936487923 2:112942603-112942625 GAGAAAGCTGGGGCTGTGGGAGG - Intergenic
936705454 2:115067540-115067562 GAGGAAATTCTGGCTGGGCGCGG - Intronic
938207202 2:129434059-129434081 GGGGAAGCTCCGGATGTGGGTGG + Intergenic
938472206 2:131575397-131575419 AGGAAAGCTCTGGCTGTGGGAGG + Intergenic
938528553 2:132161434-132161456 GAGGAGGAGGAGGCTGTGGGAGG - Intronic
939792089 2:146590141-146590163 AAGGAAGATGTGGCTGGGTGTGG + Intergenic
940689367 2:156896200-156896222 GAGGAGGATGAGGATGTGGGTGG + Intergenic
943749846 2:191500078-191500100 GAGGCAGGGCTGGCTGTGGGTGG + Intergenic
944291771 2:198016122-198016144 GAGGTAGATGTGGCTGAGGAGGG + Intronic
944325963 2:198404189-198404211 GATGAAGATCTGTATATGGGTGG + Intronic
944380872 2:199109587-199109609 GAGGAACATCAGGCTGTGAGAGG + Intergenic
944490006 2:200248814-200248836 AAGGAAGAGCTGGCTGGGCGTGG + Intergenic
944602144 2:201313676-201313698 GGGGAGGATCAGGCGGTGGGTGG - Intronic
946189818 2:218002295-218002317 GAGGAAGGGATGGCAGTGGGTGG + Intronic
947244509 2:228031636-228031658 GAGGAGTATCTGGCCGTGTGAGG - Intronic
947565150 2:231188953-231188975 GAGGGTTTTCTGGCTGTGGGTGG - Intergenic
947633299 2:231667019-231667041 GAGCTATATTTGGCTGTGGGGGG + Intergenic
947706641 2:232281735-232281757 GAGGAAGAGCAGGCATTGGGTGG + Intronic
1169016924 20:2299612-2299634 AAGGAAAATCAGGCTGAGGGAGG - Intronic
1169326110 20:4678184-4678206 GACAAAGATCTAGCTGAGGGAGG + Intergenic
1170082542 20:12492356-12492378 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1170521583 20:17191214-17191236 CAGGAAGGTCTGCCTGTGGCCGG + Intergenic
1170687427 20:18582035-18582057 GAGGAAAATCTGGACCTGGGAGG - Intronic
1170933405 20:20789857-20789879 TAGGAAAATCTGTGTGTGGGAGG + Intergenic
1171127292 20:22613628-22613650 AAGGAAGATTGGGCAGTGGGTGG - Intergenic
1171204340 20:23267325-23267347 CAGGAAGCTCAGGCAGTGGGAGG - Intergenic
1172511466 20:35503983-35504005 GAGGAAGAGCTGGCAGTGGAGGG + Exonic
1172705007 20:36876475-36876497 GAGGCAGGTCTAGCTGTGTGTGG - Intronic
1173017941 20:39243876-39243898 GAGAAATATCTGGATGTGGAAGG + Intergenic
1173553233 20:43948025-43948047 AAGGAAGCTCTGGCTGAGAGAGG - Intronic
1174451883 20:50625687-50625709 GAGGGAGACCTGGCTGAGGAGGG + Intronic
1174879960 20:54268194-54268216 GGGCAAAATCTGGCAGTGGGAGG + Intergenic
1175345779 20:58273711-58273733 GAGGAAGCTATGGCCATGGGGGG + Intergenic
1175505308 20:59479499-59479521 GGGGAAGTTCTGGCTGATGGCGG + Intergenic
1175823930 20:61926414-61926436 GAGGCAGCGCTGGCTGGGGGAGG - Intronic
1175901867 20:62363140-62363162 GGGCAAGATCTGGAGGTGGGGGG - Intronic
1176767943 21:13038456-13038478 GAGGAGGAGGAGGCTGTGGGAGG + Intergenic
1178411218 21:32365152-32365174 GAGGCACATCTGGCTGGGTGTGG + Intronic
1179725822 21:43340744-43340766 GAGGCAGGTCAGGCTGTCGGGGG + Intergenic
1180127549 21:45802599-45802621 GAGGAGGACCGGGCTGGGGGAGG + Intronic
1180432505 22:15264738-15264760 GAGGAGGAGGCGGCTGTGGGAGG + Intergenic
1180470677 22:15652413-15652435 AGGAAAGCTCTGGCTGTGGGAGG + Intergenic
1180472679 22:15675012-15675034 AGGAAAGCTCTGGCTGTGGGAGG + Intergenic
1180515077 22:16132718-16132740 GAGGAGGAGGCGGCTGTGGGAGG + Intergenic
1180553226 22:16557549-16557571 TGGGCAGAGCTGGCTGTGGGTGG + Intergenic
1180794398 22:18595011-18595033 GAAGGAGATCTTTCTGTGGGTGG + Intergenic
1181227342 22:21400309-21400331 GAAGGAGATCTTTCTGTGGGTGG - Intergenic
1181251308 22:21534530-21534552 GAAGGAGATCTTTCTGTGGGTGG + Intergenic
1181968254 22:26671525-26671547 TAGTAGGATCTGGCTGCGGGGGG - Intergenic
1182087538 22:27571723-27571745 GAGAAAGATCTGGGGGTGAGGGG - Intergenic
1182180169 22:28339263-28339285 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1182533578 22:30982241-30982263 GAGGAAGATCTCCCTTTAGGGGG + Intergenic
1183440982 22:37823060-37823082 GATGAAGATATGGCGATGGGGGG - Intergenic
1183744110 22:39683708-39683730 GGGGCAGGTCTGGGTGTGGGGGG - Intronic
1184418713 22:44366933-44366955 AAGGAAGATATGGTTGGGGGAGG - Intergenic
1184531848 22:45061385-45061407 GGGGAGCAGCTGGCTGTGGGAGG - Intergenic
1184749327 22:46475521-46475543 GAGGAAGTTCTGGAGGTGGATGG + Intronic
1184763770 22:46561097-46561119 GAGCAAGGGCTGGCTGTGGGAGG + Intergenic
1185245921 22:49772758-49772780 CAGCACGATCAGGCTGTGGGTGG + Intergenic
1185263757 22:49886517-49886539 GGGGATGACCTGGCTGAGGGTGG - Exonic
1185299126 22:50070368-50070390 GAGGAAGGTGGGGTTGTGGGAGG - Intronic
949738743 3:7205264-7205286 GCTGAAGATCTGGTCGTGGGTGG + Intronic
950037938 3:9900572-9900594 GAGGAAGATGAGGCTGTGTGAGG + Intergenic
950415064 3:12864408-12864430 GAGGAGGAACAGGCAGTGGGGGG + Intronic
951458604 3:22922964-22922986 GAGGATGATTAGGCTGTAGGGGG - Intergenic
952978875 3:38719336-38719358 TAGGATGCTGTGGCTGTGGGGGG + Intronic
953019045 3:39102605-39102627 GGGGCAGGTCTGGGTGTGGGCGG - Intronic
953025534 3:39142807-39142829 GAGCAAGCTGTGGGTGTGGGGGG + Exonic
953405634 3:42658462-42658484 GTGGAAGAACTGGCTGTAGGCGG - Exonic
954211512 3:49100156-49100178 GAGGAGCATCTGGGTTTGGGTGG - Intronic
954640435 3:52094456-52094478 GAGATAGCTCTGGCTGTGGCTGG + Intronic
956431896 3:69195233-69195255 TAAGAAGATCTGTCTGCGGGAGG - Exonic
956838149 3:73112662-73112684 GAGGCAGATCTGGGGGTGGGAGG - Intergenic
957506329 3:81125664-81125686 GAGGCTGCTCTGCCTGTGGGAGG - Intergenic
958731817 3:97968092-97968114 GAGGAGCACCTGGCAGTGGGCGG - Intronic
959421176 3:106131000-106131022 AAGGCAGATCTGGCTGTAGGAGG - Intergenic
959646171 3:108704526-108704548 GAGGAAGAACTGGATTAGGGAGG + Intergenic
960137601 3:114121696-114121718 AAGGAAGATCGGGCTGTGGCTGG + Intergenic
960888573 3:122421486-122421508 GAGGCAGAGCTTGCAGTGGGTGG - Intergenic
961440113 3:126947763-126947785 GATGAGGATCAGCCTGTGGGAGG - Intronic
961543909 3:127618869-127618891 CAGGCAGTTCTGGGTGTGGGTGG - Intronic
961956100 3:130805390-130805412 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
962320548 3:134387027-134387049 TATGGAGATGTGGCTGTGGGTGG + Intergenic
962403818 3:135083337-135083359 GAGGAAGGCCTGGCTGAGGCAGG + Intronic
962840546 3:139228525-139228547 GAGGAAGATTTGGATTCGGGTGG + Intronic
964261773 3:154847644-154847666 AAGGAAAATCTCGCTGTGGCTGG + Intergenic
967175048 3:186855237-186855259 GAGGAAGCTCTGCTTGGGGGAGG - Exonic
968069214 3:195775490-195775512 GTGGAAGGTATGGCTGTGGAAGG - Intronic
968069369 3:195776135-195776157 GTGGAAGGTATGGCTGTGGAAGG - Intronic
968069423 3:195776360-195776382 GTGGAAGGTATGGCTGTGGAAGG - Intronic
968069800 3:195777890-195777912 GTGGAAGGTATGGCTGTGGAAGG - Intronic
968443199 4:634821-634843 GACGAAGATGTGAGTGTGGGGGG + Exonic
968800741 4:2742012-2742034 CAGGAACATCTGGCAGAGGGAGG - Exonic
969292691 4:6250994-6251016 GAGGAAGATTTGACTCTTGGAGG - Intergenic
970065684 4:12090742-12090764 GAGGAGTATCTGGCTGTGTGAGG - Intergenic
973859006 4:55042045-55042067 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
974244078 4:59291045-59291067 GAGCAAGACCTGGCTGGGCGCGG + Intergenic
974775349 4:66473173-66473195 GGGTAAGAACTGGCTGTGGATGG + Intergenic
974821072 4:67067739-67067761 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
975136289 4:70877769-70877791 GAAGATGATCTGGGAGTGGGTGG - Intergenic
975578229 4:75884136-75884158 AAAGAAAATCTGGCTGTGTGCGG + Intronic
976143753 4:82020321-82020343 GAGGAGTACCTGGCTGTGTGAGG - Intronic
976342246 4:83958415-83958437 GAGGCAGAGCTGGCAGTGAGCGG - Intergenic
976349018 4:84039684-84039706 CAGAAAGGTGTGGCTGTGGGAGG - Intergenic
976729110 4:88244586-88244608 AAGGAAGTTCTCACTGTGGGTGG - Intergenic
977333316 4:95664475-95664497 GAGGAGTATCTGGCCGTGTGAGG - Intergenic
977335493 4:95693399-95693421 GACTAAAATCTAGCTGTGGGGGG - Intergenic
977350476 4:95878822-95878844 TAGGAATATCTCGTTGTGGGAGG + Intergenic
977580929 4:98724034-98724056 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
978336315 4:107672830-107672852 GAGGAGTACCTGGCTGTGTGAGG - Intronic
979928171 4:126594239-126594261 GAGGAAGCTCTGGATGAGTGAGG + Intergenic
980126120 4:128775974-128775996 GAGAGAGAGCAGGCTGTGGGAGG + Intergenic
980231464 4:130051569-130051591 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
980655539 4:135779303-135779325 GAGCAAGAACTGGGTGTAGGAGG - Intergenic
981400952 4:144313430-144313452 GGGGAAGAACTGGTGGTGGGTGG + Intergenic
981528734 4:145732968-145732990 GAGGAAAACCTGGCGGTGGAAGG - Intronic
985270278 4:188187713-188187735 AAGAAAGACCTGGCTGGGGGAGG - Intergenic
985554101 5:547633-547655 GAGGAAGCCCTGGCTCTGTGGGG + Intergenic
985836865 5:2278025-2278047 GAGGAAGCTCTGTCTGCCGGAGG + Intergenic
985914025 5:2903994-2904016 GAGGAGGCTGTGGCTGTGGCGGG + Intergenic
987315093 5:16716684-16716706 CAGGAAGACGTGGCTGGGGGTGG + Intronic
988871652 5:35396848-35396870 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
989842678 5:46099820-46099842 GAGGAATTACTGGATGTGGGGGG - Intergenic
990437536 5:55808689-55808711 GAGGAGTACCTGGCTGTGTGAGG + Intronic
991478885 5:67055241-67055263 GAGGAAGGTCAGGAAGTGGGAGG + Intronic
991538882 5:67704428-67704450 GAGGGGTATCTGGCTGTGTGAGG - Intergenic
992235777 5:74707061-74707083 GAGGAATACCCGGCTGTGTGAGG - Intronic
992599813 5:78387962-78387984 GAGGAGGATCAGGCGGTGGCAGG + Intronic
992632987 5:78699811-78699833 GAGGAAGAGCTGGATGAGGGTGG + Intronic
993559626 5:89389489-89389511 GAGGAAAATATGGCAGTTGGAGG + Intergenic
994834786 5:104835507-104835529 GAGGCAGAGCTGGCAGTGAGCGG + Intergenic
995408534 5:111829332-111829354 GAGGAAGAATTGGCAGGGGGAGG + Intronic
995570135 5:113471543-113471565 GAGGAGTACCTGGCTGTGTGAGG + Intronic
996764673 5:127023896-127023918 GACTAAGCTTTGGCTGTGGGAGG - Intronic
997112256 5:131087910-131087932 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
997387718 5:133486751-133486773 GAGCAGGAGCTGGCGGTGGGTGG + Intronic
997399614 5:133592103-133592125 GAGGAAGACCAGGATCTGGGTGG - Intronic
998957728 5:147454138-147454160 GACGAGGAGCTGGCTGGGGGCGG - Intronic
999064705 5:148673568-148673590 GAGGAGTATCTGGCCGTGTGAGG + Intronic
999223427 5:150000523-150000545 GAGGAAGCTGTGGCTGCCGGCGG - Exonic
1000091967 5:157937768-157937790 GAGGAAGAGCTTGCAGTGAGTGG - Intergenic
1000483823 5:161813479-161813501 GAGGAAGAAATTCCTGTGGGGGG - Intergenic
1000587836 5:163122203-163122225 GAGGGATACCTGGCTGTGTGAGG + Intergenic
1001242647 5:170081896-170081918 GAGGAAGGTCTGGCTGAGGCGGG - Exonic
1001588478 5:172849575-172849597 GAGGAAGCTGAGGCTTTGGGGGG + Intronic
1002212440 5:177606951-177606973 GAGGGCGATCTTGCTGGGGGTGG - Intronic
1005511345 6:26514545-26514567 GAGGAATATCTCGCTGGGTGCGG + Intergenic
1005573105 6:27165933-27165955 GTGAAAGATCTGGCTGGGCGCGG - Intergenic
1005773311 6:29099913-29099935 GAGGAAGAGTTGGCTGTGGCAGG + Intergenic
1005779361 6:29172387-29172409 GAGGAAGAGTTGGCTGTGGCAGG + Intergenic
1006093499 6:31641995-31642017 GTTGATGATCTGGTTGTGGGTGG - Intronic
1006131398 6:31871412-31871434 GAGTCAGATGGGGCTGTGGGTGG + Intronic
1006183596 6:32168197-32168219 GAGAGAGATCTGGGTGTTGGTGG - Exonic
1006395092 6:33782064-33782086 TAGGAGGATCTGGCTGTGTTAGG - Intronic
1006474186 6:34244476-34244498 GGGGAAGAGGTGGCTGGGGGAGG - Intronic
1007471212 6:42091740-42091762 GAGAAGGCTCTGGGTGTGGGAGG + Intergenic
1007482299 6:42158216-42158238 GAGCCAGCTCTGGCTGAGGGTGG - Intronic
1007590906 6:43020533-43020555 AAGTAAGAGGTGGCTGTGGGTGG + Intronic
1007601676 6:43086031-43086053 CAGGAAAATGTGGCTGTGTGTGG - Intronic
1008978558 6:57457160-57457182 GAGGAGTAGCTGGCTGTGTGAGG + Intronic
1010271277 6:73918274-73918296 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1010281663 6:74030046-74030068 GAGGAGGACCTGGCCGTGTGAGG + Intergenic
1011480670 6:87790583-87790605 GAGGAAGAGCTGAATGTGGAGGG + Intergenic
1012317229 6:97795390-97795412 GAGGAGTATCTGGCCGTGTGAGG - Intergenic
1013117824 6:107115621-107115643 GAGGACGAACTCGCGGTGGGAGG - Intergenic
1014345795 6:120268111-120268133 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1014849810 6:126327359-126327381 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1015244151 6:131059183-131059205 GAGGCAGAGCTTGCTGTGAGCGG - Intronic
1015520039 6:134120869-134120891 GAGGCGGAGCTGGCAGTGGGTGG + Intergenic
1015717410 6:136206693-136206715 GTGGAAGAGTTGGCTGGGGGTGG + Intergenic
1016737260 6:147492794-147492816 GAGGAGGACCTGGCCTTGGGTGG - Intergenic
1016972282 6:149775411-149775433 GAGGAAAAATTGGCTGTGTGTGG + Intronic
1017344246 6:153361564-153361586 CAGGCACATCTGGATGTGGGAGG - Intergenic
1017653610 6:156605452-156605474 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1018620391 6:165725040-165725062 GAGGGAAATTTGGCTGAGGGTGG + Intronic
1018859511 6:167700513-167700535 GAGGAAGATTTGCCTGTGCTGGG - Intergenic
1018863170 6:167726942-167726964 GAGGCAGAGGAGGCTGTGGGAGG + Intergenic
1019067910 6:169317984-169318006 GTGGAAGATCGGGATGCGGGAGG - Intergenic
1019629085 7:2036978-2037000 GCGGAAGCTCGTGCTGTGGGGGG - Intronic
1019629102 7:2037054-2037076 GTGGAAGCTCATGCTGTGGGGGG - Intronic
1020874602 7:13677542-13677564 GAGGAGGACCTGGCCGTGTGAGG + Intergenic
1022948321 7:35310480-35310502 GAGTGAGGTCTGGGTGTGGGAGG - Intergenic
1023011029 7:35924967-35924989 CAGGAAGATCTGGGGGTAGGGGG + Intergenic
1023794191 7:43778530-43778552 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1024472903 7:49782012-49782034 GAGGAAGATCTGGTTCTAGGAGG + Intronic
1024741202 7:52356724-52356746 AAGGAAGAGGTGGCTATGGGTGG + Intergenic
1025727790 7:64082809-64082831 GAGGCAGATGTTGCTGTGAGCGG + Intronic
1025868395 7:65407178-65407200 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1026436003 7:70399278-70399300 AAGGAAGACCTGGCTGGGTGTGG - Intronic
1026766060 7:73160577-73160599 GAGGAGCATCTGGGTGTGGCTGG + Intergenic
1026830680 7:73608145-73608167 GAGGAAGATCAGGCTGGGTGAGG - Intronic
1026886094 7:73947112-73947134 TAGAAAGATCTGGCTGGGCGTGG - Intergenic
1027042535 7:74970273-74970295 GAGGAGCATCTGGGTGTGGCTGG + Intronic
1027081108 7:75232084-75232106 GAGGAGCATCTGGGTGTGGCTGG - Intergenic
1027330689 7:77089911-77089933 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1028686326 7:93592308-93592330 GAGGAAGATGGAACTGTGGGAGG - Intronic
1028837708 7:95393695-95393717 GAAGCAGAGCTGGTTGTGGGTGG + Intronic
1029491247 7:100871504-100871526 CAGGAAGATCTGGGAGCGGGCGG - Intronic
1029525201 7:101089630-101089652 GAGGCAGAGCTGTCCGTGGGAGG + Exonic
1029936031 7:104424909-104424931 GAGGAAGAGCTTGCAGTGAGCGG + Intronic
1029969603 7:104776447-104776469 AAGGAGAAGCTGGCTGTGGGGGG - Intronic
1029986423 7:104927266-104927288 GAGCAGGAGCGGGCTGTGGGCGG + Intergenic
1031002934 7:116438373-116438395 GAGAAAGAGGGGGCTGTGGGAGG + Intronic
1032087913 7:128893355-128893377 GAGGCAGATCTGGGTGTGAGCGG + Intronic
1032334132 7:131008938-131008960 GAGGAAGGTCTGTCTGTAGGGGG + Intergenic
1033961549 7:146919714-146919736 AAGGAGGATCAGGCAGTGGGCGG + Intronic
1034285649 7:149881602-149881624 GAGGAAGATGAGGCTGCAGGAGG + Intergenic
1034980104 7:155470307-155470329 GAGGAAGAGCTGGGTTGGGGTGG - Intergenic
1035037916 7:155907422-155907444 GAGCCAGGTCTGTCTGTGGGCGG + Intergenic
1035428157 7:158796079-158796101 GTGATAGATGTGGCTGTGGGAGG - Intronic
1035564277 8:630883-630905 GAGTCAGCTCTGTCTGTGGGTGG - Intronic
1035680292 8:1482948-1482970 GAGGATGGCCGGGCTGTGGGAGG - Intergenic
1036727699 8:11234177-11234199 AAGGAAGAGCTAGCTCTGGGAGG - Intergenic
1037359089 8:18054214-18054236 GAGGAAGCCCGGGCTGTGGGAGG + Intergenic
1037381281 8:18287831-18287853 GGGGAAGATTTGGCCGTGCGTGG + Intergenic
1037828150 8:22172185-22172207 GAAGCAGATGTTGCTGTGGGTGG + Intronic
1037877286 8:22554350-22554372 GAGGAGGGGCCGGCTGTGGGAGG - Intronic
1037925342 8:22839776-22839798 GTGGAAGAGCTGGCAGTGGGAGG - Intronic
1038418698 8:27418011-27418033 GAGGGACATCTGGTTGGGGGAGG - Intronic
1038492763 8:27982279-27982301 GAGGCCGATCTGGGAGTGGGTGG - Intronic
1038684679 8:29705467-29705489 GAGGCAGATCTTGCAGTGAGCGG + Intergenic
1038929028 8:32172115-32172137 GAGGAGTACCTGGCTGTGGGAGG - Intronic
1039423096 8:37461042-37461064 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1039470786 8:37812554-37812576 GAGGCAGAGCTTGCAGTGGGCGG + Intronic
1039695435 8:39905547-39905569 GAGGAAGAGCTGGATGTGGGAGG - Intronic
1040438978 8:47421981-47422003 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1040598106 8:48859631-48859653 GAGGAAGCTGTGCCTGGGGGTGG - Intergenic
1041203839 8:55477161-55477183 GAGGAGTATCCGGCTGTGTGAGG - Intronic
1041364201 8:57083741-57083763 GGGGAGGAACTGGCAGTGGGCGG - Intergenic
1041461185 8:58113443-58113465 GATGAAGTTCAGGCTGTGTGAGG - Intronic
1041845322 8:62321701-62321723 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1043336991 8:79188315-79188337 GAGGAAGAGAAGGCAGTGGGTGG - Intergenic
1045071099 8:98505778-98505800 GAGGGGCATCTGGCTGTGTGAGG + Intronic
1045293495 8:100853077-100853099 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1045360336 8:101426515-101426537 GAGGAATACCCGGCTGTGTGAGG - Intergenic
1045677164 8:104619988-104620010 GAGGGGGATCTGGCTGTAGAAGG + Intronic
1045775179 8:105794450-105794472 GAGGAGTATCTGGCTGTGTGAGG + Intronic
1046256976 8:111712885-111712907 GTAGAAGCTCTGGCTTTGGGTGG - Intergenic
1046489795 8:114936591-114936613 GAGGAAGATGTGACTATGGGAGG + Intergenic
1046812670 8:118549300-118549322 GAGGAGTACCTGGCTGTGTGAGG - Intronic
1048036694 8:130683799-130683821 TAGAAAGATGTGGCTGGGGGTGG - Intergenic
1048090653 8:131237010-131237032 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1048633460 8:136269956-136269978 GATGAAGATCTGACACTGGGAGG - Intergenic
1048867997 8:138774909-138774931 CAGGATGATGTGGCTGTGGAGGG + Intronic
1049146443 8:141004147-141004169 GAGGCAGAGCTTGCAGTGGGTGG + Intergenic
1049334325 8:142074741-142074763 GAGGAGCCTCTGGGTGTGGGAGG + Intergenic
1049760257 8:144329002-144329024 GGGAAAGCACTGGCTGTGGGCGG + Intergenic
1049907776 9:235269-235291 GAGGAGTACCTGGCTGTGTGAGG + Intronic
1051545157 9:18265349-18265371 TAGGAAGCACTGGCTATGGGTGG - Intergenic
1051739171 9:20235098-20235120 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1052348780 9:27436979-27437001 GGGGAAGAGCTGGGAGTGGGGGG + Intronic
1052348789 9:27436998-27437020 GGGGAAGACCTGGGGGTGGGGGG + Intronic
1052772984 9:32706446-32706468 AAGTAAGGTCTGGCAGTGGGAGG - Intergenic
1052821162 9:33138822-33138844 GAAGCAGGTCTGGCTGTAGGTGG - Intronic
1053022055 9:34701662-34701684 GGGGAGGCTCGGGCTGTGGGTGG + Intergenic
1053412505 9:37924909-37924931 GAGGAAGATGAGGCTGTGGTGGG - Intronic
1053668972 9:40341111-40341133 GAGTAAGAGCTGGCTGGGTGTGG + Intergenic
1053707171 9:40767774-40767796 GAGGAGGAGGCGGCTGTGGGAGG - Intergenic
1053918771 9:42967371-42967393 GAGTAAGAGCTGGCTGGGTGTGG + Intergenic
1054380109 9:64481148-64481170 GAGTAAGAGCTGGCTGGGTGTGG + Intergenic
1054417084 9:64888542-64888564 GAGGAGGAGGCGGCTGTGGGAGG - Intergenic
1054515639 9:66035183-66035205 GAGTAAGAGCTGGCTGGGTGTGG - Intergenic
1055909694 9:81334894-81334916 GAGGCAGAGCTTGCAGTGGGTGG - Intergenic
1056299549 9:85227187-85227209 GAGGTAGCATTGGCTGTGGGCGG + Intergenic
1056521228 9:87403268-87403290 AAGGATGATCTGGCTGAGTGTGG - Intergenic
1056765759 9:89443564-89443586 GAGGAGGATCTGCCTGGGGTAGG + Intronic
1057272435 9:93658561-93658583 GAGGAAGGTGGGTCTGTGGGTGG + Intronic
1057682830 9:97205912-97205934 GAGGAATATTCGGCTGTGTGAGG - Intergenic
1057691535 9:97290954-97290976 TAGGAAGTCCTGGCTGTGAGTGG + Intergenic
1057880795 9:98791380-98791402 GAGGAAGATCTGGCCTAGGCTGG - Intronic
1058151984 9:101473469-101473491 GAGGAAGATCTAGAAGTGGGTGG + Exonic
1060306109 9:122414015-122414037 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1060596489 9:124852074-124852096 GAGCCACATCTGGGTGTGGGGGG + Intergenic
1060729646 9:126029308-126029330 GAGGAAAATGAGGCTCTGGGAGG + Intergenic
1061003553 9:127916058-127916080 GAGAGAGAGCTGGATGTGGGGGG - Intronic
1061578929 9:131524949-131524971 GAGGAAGCAGTGGGTGTGGGTGG + Exonic
1061631619 9:131875701-131875723 GAGGATGGTTTGGGTGTGGGAGG - Intronic
1061773751 9:132946743-132946765 AAGGAAGGTCAGGGTGTGGGGGG - Intronic
1062028420 9:134351089-134351111 GAGGAAGCGCTGGCTGCAGGGGG + Intronic
1062141084 9:134959513-134959535 GAGGAAGACCTGGCTCCAGGTGG + Intergenic
1062148814 9:135007056-135007078 GGGGAGGACCTGGCTGTGGAGGG - Intergenic
1062225190 9:135446446-135446468 GAGGAAGGGCTGGCTGGGGTGGG + Intergenic
1062225301 9:135446763-135446785 GAGGAAGGGCTGGCTGGGGTGGG + Intergenic
1062225354 9:135446903-135446925 GAGGAAGGGCTGGCTGGGGTGGG + Intergenic
1062225409 9:135447044-135447066 GAGGAAGGGCTGGCTGGGGTGGG + Intergenic
1062225462 9:135447184-135447206 GAGGAAGGGCTGGCTGGGGTGGG + Intergenic
1062225476 9:135447230-135447252 GAGGAAGGGCTGGCCGTGGCAGG + Intergenic
1062456306 9:136640842-136640864 GAGGCAGTCCAGGCTGTGGGTGG - Intergenic
1186406170 X:9305461-9305483 GAGAAACATCTGGCTGAAGGAGG - Intergenic
1186571131 X:10715814-10715836 GAGGAGTACCTGGCTGTGTGAGG - Intronic
1187290958 X:17952732-17952754 GTGGGAGATCTGGGTGTGGCAGG - Intergenic
1187520500 X:20009591-20009613 GAGGTAGAAGTGGCTGTGAGTGG + Intronic
1187544389 X:20233446-20233468 GAGGTAGATCTGGCTGGGCATGG + Intronic
1187624001 X:21089936-21089958 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1188930754 X:36108301-36108323 GAGGTAGATTTGGATCTGGGAGG - Intronic
1189417945 X:40831596-40831618 CAGGAACATCTGGCAGAGGGAGG - Intergenic
1190319663 X:49172534-49172556 GAGGAAGAACTGGCGAAGGGCGG - Intronic
1191075190 X:56445469-56445491 GAGGCAGAGCTTGCAGTGGGCGG - Intergenic
1192101113 X:68265298-68265320 GAGGAGTACCTGGCTGTGTGAGG - Intronic
1192683783 X:73282117-73282139 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1193562973 X:83042483-83042505 GAGGAAGAGGTTGCAGTGGGCGG + Intergenic
1193735139 X:85147592-85147614 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1194128108 X:90045308-90045330 GAGGCAGAGCTGGCAGTGAGCGG - Intergenic
1195580232 X:106493411-106493433 GGGGAAGGGATGGCTGTGGGTGG - Intergenic
1195696978 X:107674528-107674550 GAGGAGGATCTGGATGTGACTGG - Intergenic
1196892205 X:120302239-120302261 GTGGAATATCTTACTGTGGGTGG - Intronic
1197253441 X:124237938-124237960 GAGGAAGATGTGGCAGTTAGAGG + Intronic
1197543027 X:127789538-127789560 GAGGAATACCTGGCCGTGTGAGG - Intergenic
1199125765 X:144117677-144117699 GAGGAATATCTGGCAGAGGGAGG - Intergenic
1200138723 X:153886850-153886872 GAGGAAAATCTGGGAGTTGGGGG - Intronic
1200214715 X:154362640-154362662 GGGTAAGGCCTGGCTGTGGGTGG - Exonic
1201301289 Y:12507267-12507289 GAGGGAGATCTGCCTGGGCGTGG - Intergenic
1201599642 Y:15713750-15713772 GAGGAGTACCTGGCTGTGTGAGG - Intergenic
1201945856 Y:19509453-19509475 GAGGAGTATCCGGCTGTGTGAGG + Intergenic
1202344325 Y:23905737-23905759 GAGGAGTACCTGGCTGTGTGAGG + Intergenic
1202526443 Y:25764346-25764368 GAGGAGTACCTGGCTGTGTGAGG - Intergenic