ID: 1084316740

View in Genome Browser
Species Human (GRCh38)
Location 11:68350029-68350051
Sequence GTCTCTCAGCACTCCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 14, 3: 45, 4: 444}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084316733_1084316740 30 Left 1084316733 11:68349976-68349998 CCCCAGGCTCAGTTGGAAGCCCT 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1084316740 11:68350029-68350051 GTCTCTCAGCACTCCCAGCCTGG 0: 1
1: 0
2: 14
3: 45
4: 444
1084316737_1084316740 10 Left 1084316737 11:68349996-68350018 CCTTTGCCTGTTAGTTCATTCAG 0: 1
1: 0
2: 2
3: 21
4: 188
Right 1084316740 11:68350029-68350051 GTCTCTCAGCACTCCCAGCCTGG 0: 1
1: 0
2: 14
3: 45
4: 444
1084316735_1084316740 28 Left 1084316735 11:68349978-68350000 CCAGGCTCAGTTGGAAGCCCTTT 0: 1
1: 0
2: 2
3: 17
4: 242
Right 1084316740 11:68350029-68350051 GTCTCTCAGCACTCCCAGCCTGG 0: 1
1: 0
2: 14
3: 45
4: 444
1084316738_1084316740 4 Left 1084316738 11:68350002-68350024 CCTGTTAGTTCATTCAGTGTCAC 0: 1
1: 0
2: 1
3: 4
4: 126
Right 1084316740 11:68350029-68350051 GTCTCTCAGCACTCCCAGCCTGG 0: 1
1: 0
2: 14
3: 45
4: 444
1084316734_1084316740 29 Left 1084316734 11:68349977-68349999 CCCAGGCTCAGTTGGAAGCCCTT 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1084316740 11:68350029-68350051 GTCTCTCAGCACTCCCAGCCTGG 0: 1
1: 0
2: 14
3: 45
4: 444
1084316736_1084316740 11 Left 1084316736 11:68349995-68350017 CCCTTTGCCTGTTAGTTCATTCA 0: 1
1: 0
2: 0
3: 30
4: 297
Right 1084316740 11:68350029-68350051 GTCTCTCAGCACTCCCAGCCTGG 0: 1
1: 0
2: 14
3: 45
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084316740 Original CRISPR GTCTCTCAGCACTCCCAGCC TGG Intronic
901667430 1:10834803-10834825 TTCTCTAACCACTTCCAGCCCGG + Intergenic
901821258 1:11831111-11831133 GTGTGTCACCACGCCCAGCCTGG + Intronic
901844687 1:11974544-11974566 GGCCCTCAGCACTGCCTGCCTGG - Intronic
902308527 1:15562526-15562548 ATGTCACTGCACTCCCAGCCTGG - Intronic
902480871 1:16710879-16710901 CTCTCTCAGCACTCCCTACTTGG + Intergenic
902647392 1:17809713-17809735 GTCTCCCATCACTCCCAGATGGG + Intronic
902703562 1:18189588-18189610 GTCTCCCAGCACCCCCAGTGGGG - Intronic
903338990 1:22642695-22642717 GCCTCTCAGCTCTGCCAGCCTGG + Intergenic
903956325 1:27028623-27028645 GTGCCACTGCACTCCCAGCCTGG - Intergenic
904606438 1:31700398-31700420 ATCTCCCAGCACTCCAAGTCAGG + Intronic
904794123 1:33045893-33045915 GTCTCGCAGCTCTCCCCTCCTGG - Intronic
906055975 1:42917180-42917202 GTCCCCCAGCACTGCCGGCCTGG - Intergenic
906270179 1:44471381-44471403 GTGCCACTGCACTCCCAGCCTGG + Intronic
906517911 1:46450459-46450481 TTCCCTCAGCCCTTCCAGCCTGG + Intergenic
906677771 1:47705668-47705690 GTCTCCCTGCACCCCCAGCTTGG - Intergenic
907208504 1:52797549-52797571 GTACCACTGCACTCCCAGCCTGG - Intronic
907420714 1:54345387-54345409 GAGTCTCAGCCCTCCCATCCAGG + Intronic
907445974 1:54507930-54507952 CTCCCTCAGCACCCCCACCCAGG - Intergenic
907855374 1:58298555-58298577 CTCTGTCATCACTCCCAGACTGG + Intronic
910222184 1:84898775-84898797 GTCTCTCATCACCCCCAGATAGG - Intergenic
911025168 1:93427873-93427895 ATCTCTCACCACTCCATGCCTGG + Intergenic
911292294 1:96071665-96071687 GTCTCTCCCAGCTCCCAGCCAGG + Intergenic
912378768 1:109235076-109235098 TTCTCTCCCCACTCCCAGGCAGG + Intronic
912522144 1:110252977-110252999 ATCTCTCTGCTCTCCCAGGCAGG + Intronic
912635267 1:111285980-111286002 TTCACTCAGCACTGCCAGCCTGG + Intergenic
913094112 1:115500101-115500123 GTCTCCCATCACTCCCAGATGGG - Intergenic
915325386 1:155079151-155079173 GTCTCCCAGGACTCCCACCCCGG - Intronic
915512573 1:156394403-156394425 CCTTCCCAGCACTCCCAGCCTGG + Intergenic
915612959 1:157009756-157009778 GTCTTTCAGCGTTTCCAGCCAGG - Intronic
916446837 1:164880538-164880560 TTTTCCCAGCACTCCCATCCTGG + Intronic
917504204 1:175613480-175613502 GTTTATCAGCATTCCCTGCCTGG + Intronic
917965710 1:180177294-180177316 GTGCCGCTGCACTCCCAGCCTGG - Intronic
918889260 1:190243969-190243991 GTCTCTCATCACCCCCAGATGGG + Intronic
918929516 1:190835810-190835832 CTCTCACAGCACTCTCAGCTGGG + Intergenic
919749885 1:201030900-201030922 GGCTCTGAGCAGTCCTAGCCAGG + Intergenic
919916301 1:202141597-202141619 GTACCACTGCACTCCCAGCCTGG + Intronic
919919315 1:202158989-202159011 GCCTCTTCCCACTCCCAGCCAGG + Intronic
919977565 1:202622851-202622873 GTCCCTCAGCCCTCACAGGCTGG - Intronic
922417083 1:225431535-225431557 GTCTCCCAGCAGTGCCGGCCTGG + Intergenic
923377349 1:233377828-233377850 GTCTCCCATCACTCCCAGATGGG - Intronic
923567914 1:235090551-235090573 GATTCTCAGCATTCCAAGCCTGG + Intergenic
924191347 1:241556049-241556071 GTGCCACTGCACTCCCAGCCTGG + Intronic
924379457 1:243448528-243448550 GTCTCTCAGAATTCACAGTCCGG + Intronic
924657783 1:245989063-245989085 ACATCTCACCACTCCCAGCCAGG - Intronic
1063299075 10:4835559-4835581 GTCACTAAGCAACCCCAGCCTGG - Intronic
1063411485 10:5839977-5839999 GTCCCACTGCACTCCCAGCCTGG - Intronic
1063765998 10:9141240-9141262 GTCTCCCATCACCCCCAGACGGG - Intergenic
1064901868 10:20303842-20303864 GTCTCCCATCACTCCCAGATGGG + Intergenic
1065302449 10:24335333-24335355 GTGCCACTGCACTCCCAGCCTGG - Intronic
1065505828 10:26429297-26429319 GTCTCTCATCACCCCCAGATGGG + Intergenic
1066112072 10:32206519-32206541 GTGCCACTGCACTCCCAGCCTGG + Intergenic
1066510858 10:36094268-36094290 GTCACTCAGCACTGCTACCCAGG - Intergenic
1067155020 10:43774122-43774144 GGCTCCCAGCATTTCCAGCCAGG + Intergenic
1067668462 10:48299030-48299052 GCCTCACTGCCCTCCCAGCCTGG + Intergenic
1068209070 10:53896841-53896863 GTCTCTCATCACACCCAGATGGG + Intronic
1068581331 10:58743300-58743322 GTCTCTCATCAATACCAGTCTGG + Intronic
1069049618 10:63778766-63778788 GTCTCTCATCACCCCCAGATGGG + Intergenic
1069051813 10:63803114-63803136 GTGTCTCAGCACTCTCCACCAGG - Intergenic
1069829722 10:71275397-71275419 GTCTCTCAGCCCTGCCTCCCTGG - Intronic
1070710127 10:78675262-78675284 GCCTGTCAGCACTCCCAAACAGG - Intergenic
1071107724 10:82117646-82117668 GCCTCACAGCACACCCTGCCAGG - Intronic
1071324013 10:84493909-84493931 GTCTCCCATCACCCCCAGACAGG - Intronic
1071543779 10:86511736-86511758 GTGTCTCAGTATGCCCAGCCTGG - Intronic
1071719215 10:88126141-88126163 GTCTCTAAACACTCAGAGCCAGG + Intergenic
1072411154 10:95203242-95203264 GTCTCCCATCACTCCCAGATGGG + Intronic
1073188791 10:101635238-101635260 GTCTCTCATCACCCCCAGATAGG + Intronic
1073232344 10:101982777-101982799 GTCTCCCATCACTCCCAGACAGG + Intronic
1074671780 10:115799561-115799583 CTCTCCCAGAAGTCCCAGCCAGG + Intronic
1074791806 10:116896847-116896869 GTGCCACTGCACTCCCAGCCTGG - Intronic
1074853499 10:117456998-117457020 TGCTCTCAGCCCTCCCAGCAGGG - Intergenic
1074903921 10:117843700-117843722 GTCTCTCATCACCCCCAGACAGG + Intergenic
1075013205 10:118892256-118892278 GTCTTTCATCACTCCCAGATGGG - Intergenic
1077312260 11:1894274-1894296 GTGCCACTGCACTCCCAGCCTGG - Intergenic
1077559046 11:3245675-3245697 GTCTCCCACCACTCCCAGACAGG + Intergenic
1078248049 11:9594320-9594342 GTCTCTCATCACCCCAAGACAGG - Intergenic
1078702656 11:13703224-13703246 GTGTCACTGCACTCTCAGCCTGG - Intronic
1079276275 11:19040415-19040437 GAATCTCAGCATCCCCAGCCAGG + Intergenic
1079627806 11:22635942-22635964 GTCTCTCACCACTCACACTCTGG + Intronic
1080903148 11:36514613-36514635 GTCTCTCATCACCCCCAGATGGG - Intronic
1081176746 11:39936654-39936676 GTCTCTCATCACCCCCAGATAGG - Intergenic
1081426107 11:42928015-42928037 GTCTCGCTGCACACCCAGGCTGG + Intergenic
1081480614 11:43484982-43485004 GTCTCCCATCACTCCCAGATGGG + Intronic
1083448646 11:62727603-62727625 GTCTTTCAGTACTTCCAGCCGGG + Intergenic
1083672979 11:64309887-64309909 GTGCCACTGCACTCCCAGCCTGG + Intronic
1083770875 11:64866634-64866656 GTGCCACTGCACTCCCAGCCTGG + Intronic
1084316740 11:68350029-68350051 GTCTCTCAGCACTCCCAGCCTGG + Intronic
1085080587 11:73630553-73630575 GTGCCACTGCACTCCCAGCCTGG + Intergenic
1089468847 11:118704900-118704922 GTGCCACTGCACTCCCAGCCTGG - Intergenic
1089498240 11:118918563-118918585 GGCTCTAACCCCTCCCAGCCCGG + Intronic
1089701429 11:120246486-120246508 TGCTCGCAGCACTCTCAGCCAGG + Exonic
1090094521 11:123730035-123730057 CTCTCTCACCACCCCCAGCCTGG + Intronic
1090610142 11:128463716-128463738 TTCTCTCAGCCCATCCAGCCAGG + Intronic
1092346601 12:7720488-7720510 GCCTCACTACACTCCCAGCCTGG - Intergenic
1092353862 12:7778351-7778373 GACTCCCAACACACCCAGCCAGG - Intergenic
1092767862 12:11869599-11869621 GTCCCTGAGCTCTCTCAGCCGGG - Exonic
1092791212 12:12072353-12072375 GCCTCTCAGCACACCCGGCCAGG + Intronic
1094049662 12:26205168-26205190 GTACCACGGCACTCCCAGCCAGG - Intronic
1094673444 12:32594379-32594401 GTCTCCCATCACTCCCAGATGGG + Intronic
1095381623 12:41601277-41601299 GTCTCCCATCACTCCCAGATGGG - Intergenic
1096403832 12:51328352-51328374 GTCTCCCATCACCCCCAGACAGG - Intergenic
1097066388 12:56323709-56323731 CTCTGTCAGCACTGCCATCCAGG - Intronic
1097157647 12:57024623-57024645 TTCTATCACCACTCCCACCCAGG + Intronic
1098120918 12:67237244-67237266 GTCTCTCAACACTACCACACTGG - Intergenic
1098829974 12:75350193-75350215 GATTTTCAGCACCCCCAGCCAGG + Intronic
1099295389 12:80822757-80822779 GTCTCTCAGCACAAAGAGCCAGG + Intronic
1099433167 12:82613081-82613103 GTCTCTCATCACCCCCACACAGG + Intergenic
1101213610 12:102559624-102559646 ATCTCTCATCTCTCCCTGCCTGG + Intergenic
1102280800 12:111617223-111617245 CTCTGTCTGCACTCCCAGGCTGG - Intergenic
1102391062 12:112549037-112549059 GTCTCCCATCACTCCCAGATGGG - Intergenic
1102572565 12:113835910-113835932 GTTTTACAGCACTCACAGCCAGG - Intronic
1103307406 12:119976422-119976444 GTGTCACTGCAATCCCAGCCTGG - Intergenic
1104418490 12:128615478-128615500 GTCTCCCATCACTCCCAGAAGGG - Intronic
1104990757 12:132622592-132622614 GTCCCAGTGCACTCCCAGCCTGG - Intergenic
1105409115 13:20156334-20156356 ATCTCACTGCACTCCCAGGCTGG + Intronic
1106126143 13:26901409-26901431 GACTCTCAGCCCTCCCACACTGG - Intergenic
1108245183 13:48506571-48506593 CTCCCTCAGCACTGCCAGCCGGG - Intronic
1108515202 13:51194960-51194982 GTCTCCCATCACCCCCAGACGGG - Intergenic
1108559452 13:51628157-51628179 GCCTCTCAGCACGAACAGCCTGG - Intronic
1109111112 13:58319191-58319213 GTCTCTCATCACGCCCAGATGGG + Intergenic
1109533154 13:63679933-63679955 ATCTCTCACCACTCCCAGCATGG + Intergenic
1109687354 13:65838793-65838815 CTGGCTCAGCACTCACAGCCAGG - Intergenic
1110141619 13:72137723-72137745 AACTCTCAGCATTCCCAGCCTGG + Intergenic
1110849989 13:80233879-80233901 GTCTCTCATCACCCCCAGATGGG - Intergenic
1111202868 13:84962198-84962220 ACCTCTCAGCACTGACAGCCTGG - Intergenic
1111921023 13:94411269-94411291 GTCTCTCATCACCCCCAGATAGG - Intergenic
1112796561 13:103063136-103063158 TTCTCTGACCACTCCCAGCCTGG - Intronic
1113480777 13:110619014-110619036 GTCGCCCAGCACTCCCAGGAGGG - Intronic
1114485611 14:23059694-23059716 GTGCCACTGCACTCCCAGCCTGG - Intronic
1115497354 14:34019467-34019489 GGCTCACACCACGCCCAGCCTGG - Intronic
1116200337 14:41785743-41785765 GTCTCCCATCACTCCCAGAGCGG - Intronic
1116671308 14:47846245-47846267 GAATCTCAGCATCCCCAGCCAGG + Intergenic
1116958821 14:50949380-50949402 GCCACACTGCACTCCCAGCCTGG + Intergenic
1117937201 14:60919742-60919764 GTCTCTCAGAAGTTCCTGCCAGG - Intronic
1118834957 14:69471148-69471170 GTACCACTGCACTCCCAGCCTGG - Intergenic
1118992516 14:70809295-70809317 CTCTCCCAGCCCTGCCAGCCCGG - Exonic
1119423393 14:74521520-74521542 GTCTGCCAGTAGTCCCAGCCTGG + Intronic
1120236372 14:81896247-81896269 GTCTCTCATCACCCCCAGATGGG - Intergenic
1121738616 14:96236046-96236068 GTTTCACATCACTCCCATCCAGG - Intronic
1121845574 14:97169464-97169486 GTCTCTGAGCACCTCCATCCCGG + Intergenic
1124144615 15:27112481-27112503 GTACCACAGCACTCCAAGCCTGG - Intronic
1124375977 15:29128954-29128976 GTCTCTCAGCGCTTCCCACCAGG - Intronic
1124432479 15:29619347-29619369 GTGTCACTGCACTCCCAGCCTGG + Intergenic
1124484088 15:30100639-30100661 GGCTCTCAGCACTCCCAGGCTGG + Intergenic
1124519494 15:30396585-30396607 GGCTCTCAGCACTCCCAGGCTGG - Intergenic
1124539161 15:30569636-30569658 GGCTCTCAGCACTCCCAGGCTGG + Intergenic
1124625444 15:31304960-31304982 CTCTCCCAGCACGCCCAGCGGGG - Intergenic
1124759489 15:32437936-32437958 GGCTCTCAGCACTCCCAGGCTGG - Intergenic
1125056368 15:35362348-35362370 TTCTGTCAGCACTCCAAGTCAGG + Intronic
1126013904 15:44331055-44331077 GTGCCACTGCACTCCCAGCCTGG - Intronic
1126422026 15:48484833-48484855 GGCTCACAGCTCTCGCAGCCAGG + Intronic
1129210236 15:74064146-74064168 GGCTCTCGGCACTCCCAGACTGG - Intergenic
1129279217 15:74470693-74470715 GTCTCTCATCACCCCCAGACGGG - Intergenic
1129403786 15:75301256-75301278 GGCTCTCGGCACTCCCAGACTGG + Intergenic
1129476795 15:75791214-75791236 GGCTCTCGGCACTCCCAGACTGG + Intergenic
1129727428 15:77908743-77908765 GGCTCTCAGCACTCCCAGGCTGG - Intergenic
1130195749 15:81778876-81778898 GTCTCCCATCACCCCCAGACAGG - Intergenic
1130258446 15:82336766-82336788 GGCTCTCAGCACTCCCAGGCTGG - Intergenic
1130270218 15:82442306-82442328 GGCTCTTGGCACTCCCAGGCTGG + Intergenic
1130275750 15:82475523-82475545 GGCTCTCGGCACTCCCAGGCTGG - Intergenic
1130282853 15:82532743-82532765 GGCTCTCGGCACTCCCAGGCTGG + Intergenic
1130462560 15:84169627-84169649 GGCTCTTGGCACTCCCAGGCTGG + Intergenic
1130468110 15:84202915-84202937 GGCTCTCGGCACTCCCAGGCTGG - Intergenic
1130485630 15:84396819-84396841 AGCTCTCGGCACTCCCAGGCTGG + Intergenic
1130490118 15:84425166-84425188 GGCTCTTGGCACTCCCAGGCTGG - Intergenic
1130496156 15:84470627-84470649 GGCTCTCGGCACTCCCAGGCTGG + Intergenic
1130501704 15:84503916-84503938 GGCTCTTGGCACTCCCAGGCTGG - Intergenic
1130590403 15:85207513-85207535 GGCTCTCGGCACTCCCAGGCTGG - Intergenic
1130596479 15:85253194-85253216 GGCTCTCAGCACTCCCAGGCTGG + Intergenic
1130743150 15:86622899-86622921 GTCTCTCATCACCTCCAGACGGG - Intronic
1130914154 15:88291505-88291527 GTCTCTCATCACTGCCTGACTGG + Intergenic
1131035914 15:89221898-89221920 CTCTCTCAGCAACCCCACCCCGG - Intergenic
1132185551 15:99799309-99799331 GGCTCTCAGCACTCCCAGGCTGG + Intergenic
1132342968 15:101089702-101089724 GTCCCTCAGCTCTCACAGCTGGG + Intergenic
1132379018 15:101353187-101353209 GTCTCCCATCACCCCCAGACGGG - Intronic
1132431444 15:101765232-101765254 GGCTCTAAGCACTCCCAGGCTGG - Intergenic
1132744845 16:1432297-1432319 GTCTCACAGCACCCCCTGGCCGG + Intergenic
1132817575 16:1839835-1839857 TGCCCTCAGAACTCCCAGCCAGG - Exonic
1132947268 16:2538350-2538372 GTCTGTCAGCGCCCCCGGCCAGG - Intronic
1132968448 16:2673106-2673128 GTCTGTCAGCGCCCCCGGCCAGG + Intergenic
1133240728 16:4412768-4412790 GTCTCTCAGCTCTGCCACCTTGG - Intronic
1135348355 16:21708203-21708225 GTCTCTCATCACCCCCAGATGGG - Intronic
1135555469 16:23432734-23432756 GTCTCTCCTCACTCCTAGTCAGG + Intronic
1135702168 16:24642043-24642065 CTATCTCAGCTCTCCCTGCCTGG - Intergenic
1136788850 16:32952311-32952333 CACCCTCAGCACTCACAGCCTGG - Intergenic
1136880962 16:33901623-33901645 CACCCTCAGCACTCACAGCCTGG + Intergenic
1137295095 16:47084790-47084812 GTCTCTCATCACCCCCAGATGGG + Intronic
1139175351 16:64680729-64680751 GTTTCTCAGCACACCAAGTCAGG - Intergenic
1139292087 16:65868205-65868227 GGCTCCCTGCACTCCCTGCCTGG - Intergenic
1140257004 16:73346113-73346135 GTCTCTCAACACTCACAGCCAGG - Intergenic
1141635152 16:85310631-85310653 CTCTCTCAGCCATCCCAGGCTGG + Intergenic
1142266615 16:89066884-89066906 GGCTCACAGCCCTTCCAGCCAGG - Intergenic
1142287385 16:89176969-89176991 GTCTCTGTCCCCTCCCAGCCGGG + Intronic
1143446438 17:7012806-7012828 GCCTCCCAGCCCTCCCAGCCCGG - Intronic
1144282139 17:13736770-13736792 TTCTCTCAGCACCCACATCCAGG + Intergenic
1144444251 17:15312171-15312193 ATCTCTCACCACTCCCAGAGAGG - Intronic
1144627538 17:16852027-16852049 GACTCTCATCACCCCCACCCTGG - Intergenic
1144878902 17:18420692-18420714 GACTCTCATCACCCCCACCCTGG + Intergenic
1145153333 17:20523702-20523724 GACTCTCATCACCCCCACCCTGG - Intergenic
1146798519 17:35800081-35800103 GCCTCCCAGCACTCCCAGAGTGG + Intronic
1147133405 17:38421742-38421764 GACTCCCAACACTCCCACCCAGG + Intergenic
1147954322 17:44123758-44123780 GCCTCTCGGCCCTCCCCGCCGGG + Intergenic
1148837296 17:50472182-50472204 TTTCCTCAGCCCTCCCAGCCTGG + Intronic
1150288981 17:63971063-63971085 GTGTCACAACACTCCCAGGCTGG - Intronic
1150322586 17:64228442-64228464 GTCTCCCAGCACCCCCAGATAGG - Intronic
1151236771 17:72726051-72726073 GGGTCTCAGCATTCCCAGCCTGG - Intronic
1151658595 17:75507211-75507233 GGCTCTCTGCCCTCCCAGCTGGG - Intronic
1151731174 17:75912204-75912226 GTGCCTCAGCAGTGCCAGCCTGG + Exonic
1151743226 17:75997895-75997917 GTGCCACTGCACTCCCAGCCTGG - Intronic
1151984675 17:77534623-77534645 GCAGCTCAGCACCCCCAGCCTGG + Intergenic
1153511097 18:5853648-5853670 ATTTCTCAGCACTCCAAGACTGG + Intergenic
1153991779 18:10406649-10406671 GACTCACAGCACTTTCAGCCAGG + Intergenic
1154070127 18:11146494-11146516 GGTTCACAGCACTCCCAGCTTGG - Intronic
1155394149 18:25368430-25368452 GTCTCTCATCACCCCCAGATGGG - Intergenic
1155485285 18:26335019-26335041 GTCTAGCTGCACTCCCACCCTGG - Intronic
1156625205 18:38900252-38900274 GTGGCTCAGCATGCCCAGCCTGG - Intergenic
1156933901 18:42679312-42679334 GTCTCTCAAAATTCCCACCCTGG + Intergenic
1157322170 18:46642898-46642920 CTCACTCAGCGCTCTCAGCCAGG + Intronic
1157452881 18:47801307-47801329 GTCCCTGAGCAAGCCCAGCCTGG + Intergenic
1157562161 18:48655846-48655868 GTTTCTAAACACTCACAGCCTGG + Intronic
1157640374 18:49206832-49206854 GTTTCTCAGTACTCTCAGCTGGG - Intronic
1157761091 18:50266272-50266294 ATCTCTCCGCACTCCAGGCCTGG - Intronic
1158234800 18:55301016-55301038 GTCCCTCAGCACATCCGGCCTGG + Intronic
1159381951 18:67671501-67671523 GTCTCCCATCACTCCCAGATGGG - Intergenic
1159684014 18:71393927-71393949 GTGCCACTGCACTCCCAGCCTGG + Intergenic
1160122685 18:76144937-76144959 GTCTCTGAGCCCTACCAGCAGGG - Intergenic
1160281370 18:77493875-77493897 GTCTCCCATCACCCCCAGACGGG + Intergenic
1160393193 18:78552150-78552172 GTCCCCCAGCACTCCCATTCAGG + Intergenic
1160438599 18:78870821-78870843 GTCCCTCGGCTCTCCCAGCCAGG - Intergenic
1160438612 18:78870867-78870889 GTCCCTCGGCTCTCCCAACCGGG - Intergenic
1160497384 18:79383425-79383447 GTCTCCCAGCCCGCACAGCCAGG - Intergenic
1160850109 19:1186803-1186825 GTGCCACTGCACTCCCAGCCTGG + Intronic
1161171330 19:2813779-2813801 GTCTCTCAGACCCCCCAGGCCGG - Exonic
1161788741 19:6345516-6345538 GTCTCCCATCACCCCCAGCTGGG - Intergenic
1161793557 19:6374391-6374413 GTGCCTTGGCACTCCCAGCCAGG + Intronic
1161907807 19:7170280-7170302 GTCTCCCATCACCCCCAGCTGGG + Intronic
1161976305 19:7609742-7609764 GTCTCTCATCACCCCCAGCTGGG - Intronic
1162004833 19:7771053-7771075 GTCTCTCATCACCCCCAGATGGG - Intergenic
1162302187 19:9850245-9850267 GTCCCTAAGCTCTGCCAGCCAGG - Intergenic
1162711002 19:12594782-12594804 CTGTCTCAGCACTCCCACCTGGG + Intronic
1163372893 19:16912025-16912047 GTCTCCCATCACTCCCAGAAAGG + Intronic
1163384147 19:16989021-16989043 GTCTCCCACCACCCCCAGACGGG + Intronic
1163542027 19:17917364-17917386 GTCTCCCATCACTCCCAGATGGG + Intergenic
1163582214 19:18145660-18145682 GTCCCACAGCAGACCCAGCCTGG + Intronic
1164426961 19:28150210-28150232 GTGTCTCAGCACTGCCAAGCGGG + Intergenic
1164607068 19:29607149-29607171 GTGTCCCACCACACCCAGCCAGG - Intronic
1164649638 19:29882591-29882613 GGCTCTCTGCCCTCCCTGCCTGG + Intergenic
1164752134 19:30664830-30664852 AGCCCTCAGCCCTCCCAGCCGGG - Intronic
1165096571 19:33412982-33413004 GCCTCCAAGCACACCCAGCCAGG + Intronic
1165671100 19:37680079-37680101 GTCTCTCATCACCCCCAGATGGG - Intronic
1165779249 19:38422677-38422699 GTCTCTCATCACCCCCAGATGGG + Intronic
1165927456 19:39335819-39335841 GTCTCTCTGTTCTTCCAGCCGGG + Intronic
1166054197 19:40278940-40278962 GTCACTCAGCAGCCCCAGCTGGG + Intronic
1166069010 19:40376979-40377001 CTCTCTCTGCACCCCCATCCCGG - Intronic
1166074470 19:40405680-40405702 GTGCCACTGCACTCCCAGCCTGG - Intronic
1167437231 19:49486522-49486544 GCCTCTCTGCTCTCCCTGCCTGG - Intergenic
1167802463 19:51753454-51753476 GTCTCCCATCACTCCCAGATGGG + Intronic
1168507978 19:56952280-56952302 GTCTCCCATCACTCCCAGCTGGG - Intergenic
1202714907 1_KI270714v1_random:36784-36806 CTCTCTCAGCACTCCCTACTTGG + Intergenic
926533182 2:14077804-14077826 GTACCACTGCACTCCCAGCCTGG - Intergenic
926685415 2:15694221-15694243 GTCTCTCCACACAGCCAGCCCGG - Intronic
927510646 2:23642095-23642117 GCCTCTCACCTCTCCCAGGCAGG + Intronic
927591304 2:24360349-24360371 GTCCCTCAGCACCGGCAGCCTGG + Exonic
928136189 2:28689325-28689347 CTTTCTCAGCCCTCACAGCCTGG + Intergenic
928454070 2:31403509-31403531 TTCTCACATCACTCCCAGCTGGG + Intronic
931356851 2:61544755-61544777 GTGTCACAGCATTCCCAGCCTGG - Intergenic
932229802 2:70073836-70073858 CTCTCTAAGAACTCACAGCCAGG + Intergenic
932337277 2:70938406-70938428 GTCTGTAAGCACTCCCAGACAGG + Intronic
932396203 2:71450263-71450285 CTATCTCAGCACTCACAGGCAGG + Intergenic
934112750 2:88757646-88757668 GTCTCCCAGCACCCCCACACTGG + Intergenic
934474875 2:94587238-94587260 GCCTCTCAGCCCTCCCAGGGCGG - Intergenic
934660667 2:96142020-96142042 GTCTCCCATCACTCCCAGATGGG - Intergenic
935635745 2:105248553-105248575 GCCTCTCTGCATTCCCAGACAGG - Intergenic
935870967 2:107449426-107449448 GTCTCTCATCACCCCCAGGTGGG - Intergenic
936028707 2:109054079-109054101 GGGTCTCAGCATGCCCAGCCTGG + Intergenic
936163958 2:110104107-110104129 GTCTCCCAGCACCCCCACACTGG + Intronic
936937705 2:117854010-117854032 GTCTCTCAGCTTTCCCTGGCAGG - Intergenic
936937717 2:117854062-117854084 GTCTCTCAGCTTTCCCTGGCAGG - Intergenic
937381073 2:121376889-121376911 GTCTCCCAGCACCCTCAGACAGG + Intronic
937850352 2:126626850-126626872 GTCTCCCATCACTCCCAGATGGG - Intergenic
938684162 2:133720726-133720748 GTCTCCCATCACTCCCAGATGGG - Intergenic
939179597 2:138788731-138788753 CTCTCCCTCCACTCCCAGCCCGG + Intergenic
939466369 2:142562052-142562074 GTCCCTCAGCACAGACAGCCTGG + Intergenic
940128935 2:150359605-150359627 GTATCACTGCACTCCAAGCCTGG - Intergenic
940922676 2:159327092-159327114 GTACCACTGCACTCCCAGCCTGG - Intronic
941419952 2:165271471-165271493 GTGTCTCAGCTTACCCAGCCTGG + Intronic
942479493 2:176368710-176368732 GTCTCCCATCACTCCCAGAAGGG + Intergenic
942676149 2:178428582-178428604 GTGCCACTGCACTCCCAGCCTGG - Intergenic
943343551 2:186710165-186710187 GTGTCTCAGTTCCCCCAGCCTGG - Intronic
944013927 2:195009256-195009278 GTCTCTCAGCACTGCCAGATGGG - Intergenic
945867918 2:215197028-215197050 ATGTCACTGCACTCCCAGCCTGG - Intergenic
946005342 2:216520138-216520160 GTCTCTAAGCACATACAGCCTGG - Intronic
946744902 2:222835955-222835977 GTGCCACTGCACTCCCAGCCTGG - Intergenic
946845664 2:223856739-223856761 GACTCTCTGCACACCAAGCCTGG - Intronic
947169665 2:227298644-227298666 GTCTGTCAGTATTGCCAGCCAGG - Intronic
947201762 2:227620546-227620568 GTCTCTCATCACCCCCAGATGGG + Intronic
947634615 2:231673620-231673642 GTGTCTGACCCCTCCCAGCCAGG + Intergenic
948535769 2:238645497-238645519 GTCTCCCATCACTCCCAGATGGG + Intergenic
1169009960 20:2242279-2242301 GTGCCACTGCACTCCCAGCCTGG + Intergenic
1170789772 20:19498144-19498166 GTCTCTCATCACCCCCAGATGGG + Intronic
1170979753 20:21200508-21200530 GTCTCCCATCACTCCCAAACGGG - Intronic
1171134775 20:22686416-22686438 GTCTCTGTGCCCTCCCAGCCAGG - Intergenic
1171962423 20:31504308-31504330 GTATCACTGCACTCCCAGTCTGG - Intergenic
1172166835 20:32904667-32904689 GTACCACTGCACTCCCAGCCTGG - Intronic
1172442742 20:34977567-34977589 GTGTCACAGCCCCCCCAGCCTGG - Intronic
1172757098 20:37293306-37293328 GTCTCCCATCACCCCCAGACGGG - Intronic
1172900660 20:38332236-38332258 GACTCACAGCACTCCCTGCAGGG - Intronic
1173301993 20:41812063-41812085 GTCCCACTGCACTCCCAGCCTGG - Intergenic
1174714831 20:52746609-52746631 GTCTCCCATCACCCCCAGACAGG + Intergenic
1175785752 20:61710813-61710835 GTCTCTCGGCACTTCGAGCAGGG - Intronic
1176160294 20:63644119-63644141 GTCTCTCTGAACTCCCGTCCTGG - Intronic
1176386464 21:6140606-6140628 AGCTCTCAGCTCTCCCTGCCTGG - Intergenic
1177146265 21:17410417-17410439 GTCTCCCATCACCCCCAGACGGG + Intergenic
1177296950 21:19187966-19187988 GTCTCCCATCACTCCCAGATGGG + Intergenic
1177404294 21:20645717-20645739 GGCCCTCAGCACTAACAGCCGGG + Intergenic
1178305088 21:31484676-31484698 GTCTCTCAGGCCTCCCTTCCTGG - Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179737009 21:43397646-43397668 AGCTCTCAGCTCTCCCTGCCTGG + Intergenic
1179949449 21:44701562-44701584 GTCTCCCATCACCCCCAGACGGG - Intronic
1181040748 22:20191559-20191581 GTCGGGCATCACTCCCAGCCAGG - Intergenic
1182294964 22:29307165-29307187 GACCCCCAGCACTCCCTGCCTGG + Intronic
1182417397 22:30230014-30230036 GTGCCACTGCACTCCCAGCCTGG + Intergenic
1183160326 22:36108993-36109015 GTCTCCCATCACTCCCAGATGGG - Intergenic
1183271260 22:36863912-36863934 GTCTCTCAGCACCCCTTCCCAGG - Intronic
1183466131 22:37981297-37981319 GTCTCTCAGGACCCCCCTCCAGG + Intronic
1183575155 22:38683285-38683307 GTCTCCCATCACCCCCAGACAGG - Intronic
1184093004 22:42302117-42302139 GCCCCTCAGCTCTCCCAGACTGG - Intronic
1184152482 22:42646902-42646924 GTCGCTGAGCACTCACAGCCGGG + Intronic
1184172771 22:42769411-42769433 GACCCTCAGGGCTCCCAGCCAGG + Intergenic
1184266443 22:43349414-43349436 TTCTCTCAGGACTCCCAGCTGGG + Intergenic
1184422270 22:44389170-44389192 CTTCCTCAGCACTCCGAGCCTGG - Intergenic
1184935297 22:47716475-47716497 AACTATCAGGACTCCCAGCCAGG + Intergenic
949668569 3:6370576-6370598 GTCTCTCATCACCCCCAGATGGG + Intergenic
950089712 3:10286933-10286955 GTCACTCAGCAGTCCCTGCTGGG - Intronic
950410789 3:12835365-12835387 GTGCCACTGCACTCCCAGCCTGG + Exonic
952365530 3:32671539-32671561 GTCTTTCATCACTCCCAGATGGG - Intergenic
952983669 3:38758737-38758759 CTCTCTCTGCCATCCCAGCCTGG + Intronic
956552058 3:70472310-70472332 GTCTTTCATCACTCCCAGATGGG + Intergenic
956629907 3:71305987-71306009 GGCTCTCAGGGCTCCCAGGCTGG + Intronic
957553207 3:81733271-81733293 GTCTCCCATCACCCCCAGACAGG + Intronic
957805801 3:85147230-85147252 GTGCCACAGCACTCCAAGCCTGG + Intronic
959923106 3:111891471-111891493 GTCTCCCATCACTCCCAGATGGG + Intronic
961373734 3:126448859-126448881 TCCTCTCAGCGCTTCCAGCCAGG - Intronic
961596934 3:128025348-128025370 CTCTCCCAGCTCTCCCAGCTAGG + Intergenic
963448698 3:145448870-145448892 GTGTCTCAGCACTCCAAGAGTGG + Intergenic
963939915 3:151087156-151087178 GTCGCCCAGCACCCCCAGCCTGG - Intronic
964041755 3:152269243-152269265 GTCCCTCAGCACCTCCTGCCCGG + Intronic
965450511 3:168832707-168832729 GTCTCCCATCACTCCCAGATGGG + Intergenic
968079424 3:195835941-195835963 ATCTCTCAGCCCTCCCGGACAGG + Intergenic
968175408 3:196545090-196545112 GTGCCACTGCACTCCCAGCCTGG - Intergenic
968530971 4:1091477-1091499 GTCTGTCGGCCCTTCCAGCCTGG - Intronic
968646229 4:1742050-1742072 GTATCACTGCACCCCCAGCCTGG + Intronic
969233210 4:5846404-5846426 GTCTCTCAGCTCTCTCATCAGGG + Intronic
969299083 4:6286954-6286976 GTCTCTCTGTACTCCTGGCCTGG + Intronic
969399268 4:6943147-6943169 GGCTCTCAGAACTCCCACACTGG - Intronic
970376162 4:15459271-15459293 TTCTCTCCTCACTGCCAGCCTGG - Intergenic
972168929 4:36321498-36321520 GTCTCCCATCACCCCCAGCTGGG + Intronic
972362530 4:38341041-38341063 GTCTCCCATCACTCCCAGATGGG + Intergenic
972667805 4:41183999-41184021 GTCTCCCATCACTCCCAGATGGG - Intronic
972956293 4:44396092-44396114 GTCTCTCATCACCCCCAGATGGG - Intronic
973037627 4:45426021-45426043 GTCTCTCATCACCCCCAGATGGG - Intergenic
973650768 4:52995195-52995217 GTCTCCCATCACTCCCAGATGGG - Intronic
973992238 4:56421243-56421265 GTCTCCCATCACTCCCAGATGGG + Intronic
974553868 4:63418167-63418189 GTCTCCCATCACTCCCAGATGGG - Intergenic
974811150 4:66947637-66947659 GTCTCTCATCACCCCCAGATGGG + Intergenic
975349801 4:73332368-73332390 GTCTCCCATCACTCCCAGATGGG + Intergenic
975783469 4:77863507-77863529 GCACCACAGCACTCCCAGCCTGG - Intronic
976057585 4:81086168-81086190 GTCTTTGAGAAGTCCCAGCCAGG + Intergenic
976195780 4:82530019-82530041 GTGTCTCAGCCCTCCCCTCCTGG - Intronic
977263893 4:94831944-94831966 GTCTCCCATCACTCCCAGGTGGG + Intronic
980022102 4:127722635-127722657 GAATCTCAGCATCCCCAGCCAGG - Exonic
980206995 4:129732866-129732888 GTCTCCCATCACTCCCAGATGGG - Intergenic
980625800 4:135372958-135372980 GTCTCTTAGTACAACCAGCCAGG + Intergenic
982859852 4:160434947-160434969 GAATCTCAGCATCCCCAGCCAGG - Intergenic
984117921 4:175705505-175705527 GACTCTCAGAACTCCCATCTGGG + Intronic
984480245 4:180291581-180291603 GTCTCTCATCACCCCCAGATGGG + Intergenic
985763424 5:1763632-1763654 GTCTCTCAGGACCCCCAGCAGGG - Intergenic
985989604 5:3544657-3544679 GTCTCCCTGCAGACCCAGCCTGG + Intergenic
986163144 5:5249622-5249644 CTCTCTCAGCTCTGCCATCCAGG + Intronic
986199631 5:5569499-5569521 CACTCTCTGCACCCCCAGCCTGG + Intergenic
987383108 5:17304153-17304175 GTGAGCCAGCACTCCCAGCCTGG + Intergenic
987528579 5:19084658-19084680 GTCTCCCATCACTCCCAGTTGGG + Intergenic
988833521 5:35009551-35009573 GTACCACTGCACTCCCAGCCTGG + Intronic
988909799 5:35827618-35827640 TTCTCTCAGGACCACCAGCCTGG - Intergenic
990357093 5:54979308-54979330 TTCTCTCAGAAATCACAGCCGGG + Exonic
990365524 5:55066570-55066592 GACTCTCTGCGCTCCCATCCAGG + Intergenic
991583054 5:68176510-68176532 GTGCCACTGCACTCCCAGCCTGG - Intergenic
992485669 5:77191897-77191919 GTCTCCCATCACCCCCAGACAGG - Intergenic
993923040 5:93830925-93830947 GTCTCTCATCACCCCCAGAGAGG - Intronic
994594557 5:101815672-101815694 TTCTCTCAGCACTCCATCCCAGG + Intergenic
995332036 5:110956788-110956810 GTCCCTCAGCACAAACAGCCTGG + Intergenic
996861615 5:128073385-128073407 GTCTCCCAACACCCCCAGCTGGG - Intergenic
996869266 5:128168641-128168663 GTCTCCCATCACCCCCAGACGGG - Intronic
997279068 5:132626908-132626930 TTCTCTCAGCTCTCTCAGGCTGG + Intronic
997849730 5:137320507-137320529 GTCTGTCAGCACTCTAAGTCAGG - Intronic
997984628 5:138492452-138492474 GTCTTTCAGCGGCCCCAGCCCGG + Intergenic
998467580 5:142357750-142357772 GTCCCTCACCACTTCCAGCCGGG + Intergenic
998485221 5:142496251-142496273 ATCTCTCATCTCTCCCACCCAGG - Intergenic
999261309 5:150240594-150240616 TTCCCTCAGCTCTCCAAGCCAGG + Intronic
999693766 5:154170612-154170634 GTCTCTCAGGACTCCAGGCTTGG - Intronic
999925242 5:156368786-156368808 GTCTCTCATCACCCCCAGATTGG + Intronic
1000308763 5:160020740-160020762 GTCTCTCATCACCCCCAGGTAGG + Intronic
1001910805 5:175515912-175515934 GTCTCCCATCACCCCCAGACGGG - Intronic
1002414820 5:179114515-179114537 GTGTGTCAGCACTTCCAGGCAGG - Intronic
1002935990 6:1672946-1672968 CACTCCCACCACTCCCAGCCGGG + Intronic
1003438949 6:6121996-6122018 GCCTCTCAGCACAAACAGCCTGG + Intergenic
1003712984 6:8614214-8614236 GTCTCTCATCACCCCCAGATGGG + Intergenic
1003959144 6:11192888-11192910 GTGCCACTGCACTCCCAGCCTGG + Intronic
1004340627 6:14804701-14804723 CTCTCTGTGCACTCCCAGGCTGG + Intergenic
1004433983 6:15572693-15572715 GCATTTCAGCACTCCCAGTCTGG + Intronic
1004491246 6:16118498-16118520 GTCTCTCATCACCCCCAGATGGG - Intergenic
1004911802 6:20292924-20292946 GTCTCCCATCACTCCCAGATGGG - Intergenic
1006578326 6:35061849-35061871 GCCCCTCAACACTCCGAGCCAGG - Intronic
1007346222 6:41231059-41231081 GTCTCCCATCACTCCCAGATGGG + Intronic
1011194115 6:84764568-84764590 ATCTGTCAGCACTTCCAGGCAGG + Intergenic
1011934585 6:92759517-92759539 GTCTCCCATCACTCCCAGATAGG + Intergenic
1013291135 6:108719678-108719700 TTCTCCCTGCACTCCCAGGCTGG - Intergenic
1014899453 6:126944893-126944915 GCCACTCAGCAGTCCCAGCCTGG - Intergenic
1017713856 6:157193838-157193860 ATCTCCCAGCATTCGCAGCCTGG - Intronic
1017811483 6:157987027-157987049 GTGCCACAGCACTCCCAGCTGGG - Intronic
1018586315 6:165363470-165363492 GTGCCACTGCACTCCCAGCCTGG + Intronic
1018918071 6:168150212-168150234 GTCTCTGAGGACTCCGAGCTGGG + Intergenic
1019404878 7:877838-877860 CTCTCTCAGGCCTCCCTGCCCGG + Intronic
1019578370 7:1748503-1748525 GTCTCTCAGGACGCTGAGCCCGG + Intergenic
1019701042 7:2475188-2475210 GTCACTCAGCACGCGCACCCTGG + Exonic
1019979719 7:4612586-4612608 GTCTCTCATCGCCCCCAGACAGG + Intergenic
1020444362 7:8254061-8254083 TTCTCTCCTCACTCTCAGCCAGG - Intronic
1021347785 7:19548806-19548828 GTCTCCCATCACTCCCAGATGGG - Intergenic
1021803945 7:24336480-24336502 GTGTCTCAGCACTGCCAACTGGG + Intergenic
1022222136 7:28323871-28323893 GTCTCCCATCACTCCCAGATGGG - Intronic
1022964116 7:35456987-35457009 CTCTCTCATCACTCCCACCTTGG + Intergenic
1023041380 7:36175960-36175982 GCCTCTCAGCTCTCCCAGAGAGG - Intronic
1024041625 7:45560244-45560266 GTCTCTCAGCACTTCCACAAAGG + Intergenic
1024673970 7:51621611-51621633 GTGTGGCATCACTCCCAGCCAGG - Intergenic
1025907262 7:65797131-65797153 GTCTCTTACCATTCCCAGACTGG + Intergenic
1026159578 7:67856726-67856748 GTGTCACTGCATTCCCAGCCTGG + Intergenic
1026650863 7:72214912-72214934 GTCTCCCATCACTCCCAGATAGG + Intronic
1026728959 7:72894699-72894721 GCACCTCCGCACTCCCAGCCTGG - Intronic
1027243774 7:76351714-76351736 GTCTCCCATCACCCCCAGACGGG + Intronic
1028653762 7:93178908-93178930 GTCTCTCATCACTCGCAGATGGG - Intergenic
1029156934 7:98523996-98524018 GTCTCCCATCACCCCCAGACGGG - Intergenic
1030514099 7:110519536-110519558 ATCCCTTAGCACCCCCAGCCTGG - Intergenic
1031347316 7:120684893-120684915 GTCTCCCATCACTCCCAGATAGG + Intronic
1032171423 7:129587740-129587762 GTGCCACTGCACTCCCAGCCTGG + Intergenic
1032707281 7:134432367-134432389 GTCTCCCATCACTCCCAGATGGG - Intergenic
1034162890 7:149005773-149005795 CTCACTCAGAAATCCCAGCCTGG - Intronic
1035523122 8:291079-291101 CTCTCTCTGCACTCGAAGCCCGG - Intergenic
1036644079 8:10601294-10601316 GCCTCTCACCACCCCCAGCCAGG - Intergenic
1036660256 8:10703184-10703206 TTCTCTCAGCACTACCACCACGG - Intronic
1037754231 8:21700954-21700976 GTCTCTCAGCTCCCCTAGCTTGG - Intronic
1038041376 8:23726917-23726939 GTCTCTCTCCGCTCCCAGCCGGG + Intergenic
1038523241 8:28251456-28251478 GTCTCTCATCACTCCCAGATGGG - Intergenic
1038829116 8:31037159-31037181 GTCTCCCATCACTCCCAGATAGG - Intronic
1039484523 8:37900233-37900255 GTGCCACTGCACTCCCAGCCTGG + Intergenic
1039884578 8:41647758-41647780 CTCTCCCAGCTCTCCCAGCCGGG + Intronic
1040729478 8:50425447-50425469 GTCTCTCATCACCCCCAGATGGG + Intronic
1042104108 8:65306334-65306356 GTGTCACTGAACTCCCAGCCTGG - Intergenic
1042273151 8:66976210-66976232 GTCTCTCATTACTCCCAGATAGG + Intronic
1044384837 8:91575680-91575702 GTCTCCCAGAGCTCCTAGCCTGG + Intergenic
1045323800 8:101101831-101101853 GTGCCACTGCACTCCCAGCCTGG - Intergenic
1045582902 8:103499745-103499767 GTCTCTCCTCCCTCCCCGCCCGG + Intergenic
1045724962 8:105161329-105161351 GTCTCCCATCACTCCCAGATAGG + Intronic
1047336606 8:123942285-123942307 GCCTCTCAGCCCTCACCGCCAGG + Intronic
1047878989 8:129171592-129171614 GTGTCTCAGAACTCACAGGCTGG - Intergenic
1048339160 8:133525600-133525622 GTCCCTCAGCATGCACAGCCTGG - Intronic
1049415865 8:142494817-142494839 GGCCCTCAGCACTACAAGCCAGG - Intronic
1049700317 8:144008206-144008228 GCCTCTCAGCGCACCCAGCATGG + Intronic
1049854353 8:144852309-144852331 GTTGCTCAGCTCTTCCAGCCCGG - Intronic
1050395220 9:5188383-5188405 GAATCTCAGCATCCCCAGCCAGG - Intergenic
1050613683 9:7379630-7379652 GTCTTTCCCCACTCCCAGGCAGG - Intergenic
1050617875 9:7421342-7421364 GTGTGTCACCACACCCAGCCTGG + Intergenic
1052855179 9:33402521-33402543 GCCTCTCAGCTCTCCCAGGGCGG + Intergenic
1053933172 9:43127179-43127201 GCCTCTCAGCCCTCCCAGGGCGG + Intergenic
1054296297 9:63334361-63334383 GCCTCTCAGCCCTCCCAGGGCGG + Intergenic
1054394314 9:64638866-64638888 GCCTCTCAGCCCTCCCAGGGCGG + Intergenic
1054428963 9:65144065-65144087 GCCTCTCAGCCCTCCCAGGGCGG + Intergenic
1056407006 9:86283970-86283992 GTGCCACTGCACTCCCAGCCTGG + Intergenic
1057224100 9:93278208-93278230 GTCTCTCCACACTCTCAGCTTGG - Intronic
1058930483 9:109714367-109714389 AGCTCTCATCACTCCAAGCCTGG + Intronic
1059018942 9:110552578-110552600 GTCTCCCATCACTCCCAGATGGG - Intronic
1060073496 9:120571112-120571134 GCACCTCTGCACTCCCAGCCTGG + Intronic
1060533476 9:124363854-124363876 GCCTGTCAGAACTCGCAGCCAGG + Intronic
1060978752 9:127780434-127780456 ATCTCTCAGCAACCACAGCCAGG - Intergenic
1061061641 9:128253596-128253618 GGCTCTCAGCACTCCCAGGCTGG - Intronic
1061401292 9:130369808-130369830 TCCTCTCTGCCCTCCCAGCCAGG - Intronic
1061453399 9:130681140-130681162 GGCCCTCAGCGCCCCCAGCCCGG - Intronic
1061467569 9:130793963-130793985 GTCTCTTATCACTCCCAGATAGG + Intronic
1061581209 9:131537624-131537646 GTCTCTCATCACCCCCAGATGGG - Intergenic
1062146831 9:134994243-134994265 GAGTCTCAGCACTCTGAGCCTGG - Intergenic
1062338848 9:136084587-136084609 GTCTCTGGGCTCTTCCAGCCTGG - Intronic
1062378420 9:136275305-136275327 CCCTCCCAGCACCCCCAGCCGGG - Intergenic
1062401279 9:136373797-136373819 TGCTCCCAGCCCTCCCAGCCTGG + Intergenic
1062500706 9:136850840-136850862 GCTACTGAGCACTCCCAGCCCGG + Exonic
1062525788 9:136977613-136977635 GTCGCCCAGCACCCCCAGCAGGG - Exonic
1062707669 9:137954219-137954241 GCCTCTCACCACTGCCACCCCGG - Intronic
1186006734 X:5080442-5080464 GTCTCTCATCACCCCCAGATGGG - Intergenic
1187985231 X:24802953-24802975 GTGCCACTGCACTCCCAGCCTGG + Intronic
1189353180 X:40292551-40292573 CTCTCTCATCCCTCCCACCCCGG + Intergenic
1192245760 X:69370268-69370290 GTCTCTCAACGCCTCCAGCCTGG - Intergenic
1197709960 X:129658784-129658806 GTCTCTCATCACCCCCAGATGGG + Intergenic
1199035808 X:143050215-143050237 GAATCTCAGCATCCCCAGCCAGG - Intergenic
1202368112 Y:24180408-24180430 GGCTCTCAGCACTCCCAGGCTGG + Intergenic
1202372584 Y:24208774-24208796 GGCTCTCAGCACTCCCAGGCTGG - Intergenic
1202498200 Y:25461346-25461368 GGCTCTCAGCACTCCCAGGCTGG + Intergenic
1202502673 Y:25489709-25489731 GGCTCTCAGCACTCCCAGGCTGG - Intergenic