ID: 1084318393

View in Genome Browser
Species Human (GRCh38)
Location 11:68359146-68359168
Sequence GTGATGAGGAGTGGATTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084318385_1084318393 16 Left 1084318385 11:68359107-68359129 CCTGAAACAGCAAACAGGTTTTT 0: 2
1: 1
2: 0
3: 29
4: 282
Right 1084318393 11:68359146-68359168 GTGATGAGGAGTGGATTAGCTGG 0: 1
1: 0
2: 2
3: 7
4: 146
1084318383_1084318393 30 Left 1084318383 11:68359093-68359115 CCACAACTTAACAGCCTGAAACA 0: 1
1: 1
2: 3
3: 33
4: 362
Right 1084318393 11:68359146-68359168 GTGATGAGGAGTGGATTAGCTGG 0: 1
1: 0
2: 2
3: 7
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084318393 Original CRISPR GTGATGAGGAGTGGATTAGC TGG Intronic
900419836 1:2551256-2551278 GTTATTAGGAGTGGAGTTGCTGG + Intergenic
902753772 1:18536062-18536084 GTGATGAGGAGGGTCTGAGCAGG - Intergenic
902786732 1:18737332-18737354 GTGAAGAGGAGTGGGTTTGGGGG - Intronic
905638658 1:39573870-39573892 GTGATGAGAAGTGTTTTGGCTGG - Intronic
907119043 1:51992544-51992566 GTGATGAGGAGGGGTTGAGGGGG - Intergenic
909165922 1:72223985-72224007 GTGAAGATGAGTTGATAAGCTGG - Intronic
909368848 1:74860796-74860818 GTGAGGAGGAGTGTAGTAGGAGG + Intergenic
910506983 1:87960437-87960459 GTGGTGGGGAGTGGATCAGAGGG - Intergenic
916982209 1:170150513-170150535 GTGGTGGTGAGTGGAGTAGCAGG + Intronic
917349131 1:174058525-174058547 GTGAGTTGGAGTGGATTAGGTGG + Intergenic
917515174 1:175701134-175701156 GTGTTGAGGAGGGGAATAACTGG - Intronic
917645867 1:177028243-177028265 TTGATTAGGCCTGGATTAGCTGG + Intronic
918384021 1:183986871-183986893 GTGTTGAGGGATGGATTAGAAGG - Intronic
919483779 1:198121297-198121319 CTGATGTGGAGTGGAAGAGCCGG - Intergenic
919663411 1:200269781-200269803 GTGGAGAGGAGTGATTTAGCTGG - Intergenic
1062768865 10:84514-84536 GTGATGAGGAGGGGAGGAACTGG - Intergenic
1065935447 10:30516700-30516722 GGGATGAGGACAGGAATAGCTGG - Intergenic
1068730924 10:60357039-60357061 GTGATGAGGATAGGAATAGTAGG - Intronic
1069521378 10:69124234-69124256 GGGAAGAGGAGTGGAGTAGGGGG + Exonic
1072019507 10:91384059-91384081 GTAATGAGGAGTGTATTTGGAGG - Intergenic
1072622701 10:97090503-97090525 GTGAGTTGGAGTGTATTAGCAGG + Intronic
1074658206 10:115619139-115619161 AGGATGTGGAGTGGATTTGCTGG + Intronic
1075005977 10:118830416-118830438 GGAATGAGGGGTGGATTAGGAGG - Intergenic
1077522162 11:3042908-3042930 GTGATGAGGAGGGGCTGGGCTGG - Intronic
1083348811 11:62012883-62012905 GGGATGAGGAGTGGAGTTTCCGG + Intergenic
1084318393 11:68359146-68359168 GTGATGAGGAGTGGATTAGCTGG + Intronic
1086930676 11:92689629-92689651 GTGATGAGGAGAGGAATTGATGG + Intronic
1089495795 11:118908165-118908187 GGGATGAGGACTGGACAAGCAGG + Intronic
1090218765 11:124996425-124996447 CTGAAGAGGAGAGAATTAGCTGG - Intronic
1090922310 11:131217112-131217134 TTGGTGAGGAGTGGAGTAGAGGG - Intergenic
1091113100 11:132989160-132989182 CTGCTGAGGAATGGATTCGCTGG - Intronic
1094599029 12:31892270-31892292 GTGATAGTGAGTGGATTATCAGG + Intergenic
1095338594 12:41061269-41061291 GTGATGACCAGTTGATTTGCTGG - Intronic
1096453948 12:51769993-51770015 GGGATGAGGAGCGGATGGGCTGG + Intronic
1098183659 12:67874658-67874680 GGAATGAGGACTGGAGTAGCTGG - Intergenic
1099934179 12:89105894-89105916 GTGATGAAGATAGGATTAGAAGG - Intergenic
1103954874 12:124570338-124570360 GTGTTGAGGCGGGGATGAGCTGG - Intergenic
1105910552 13:24861795-24861817 GGGATTAGGAGTGGCTTAGCTGG + Intronic
1106537817 13:30663276-30663298 GAGAAGAGGAGTGGATGAGAGGG + Intergenic
1109775685 13:67038648-67038670 ATGAAGAAGAGTGGATTATCTGG - Intronic
1113012059 13:105779502-105779524 GTAAGGTGGGGTGGATTAGCTGG - Intergenic
1113961466 13:114128580-114128602 GTGATCAGGAGAGGGATAGCTGG + Intronic
1115050951 14:29062169-29062191 GGGTTGAGGAATGGATTTGCTGG + Intergenic
1115652703 14:35414593-35414615 GTGATGAGGAGTGGCTGGGCAGG - Intergenic
1123486217 15:20741917-20741939 AAGATGAGGAGTGTAGTAGCCGG + Intergenic
1123542709 15:21310969-21310991 AAGATGAGGAGTGTAGTAGCCGG + Intergenic
1124100803 15:26690967-26690989 GAGAAGAGGACTGGATCAGCTGG - Intronic
1124499681 15:30216495-30216517 GTGATGAGGAATGGGGTAGATGG - Intergenic
1124743898 15:32322172-32322194 GTGATGAGGAATGGGGTAGATGG + Intergenic
1125088446 15:35760315-35760337 GTGATGGAGAGTGGCTTAACAGG - Intergenic
1126694094 15:51311689-51311711 GTGAGGAGGAGGGCATTGGCGGG - Intronic
1127698013 15:61470720-61470742 GGGAGGAGGAGTTGATGAGCTGG - Intergenic
1129254169 15:74324847-74324869 GGGATGAGGAGAGGAGGAGCTGG - Intronic
1130628535 15:85541027-85541049 ATGAGGAGGAGAGGATTAACTGG + Intronic
1202951026 15_KI270727v1_random:38092-38114 AAGATGAGGAGTGTAGTAGCCGG + Intergenic
1133760336 16:8793537-8793559 GTACTGAGAAGTGGATTAACTGG - Intronic
1134757840 16:16684432-16684454 GTGAAGAGGAGAGGATGATCGGG + Intergenic
1134988230 16:18674748-18674770 GTGAAGAGGAGAGGATGATCGGG - Intergenic
1137638784 16:50010333-50010355 GTGATGAGGAGTGGAGTAGAAGG + Intergenic
1138173079 16:54871276-54871298 GTGATCATGAGTGAATTATCGGG - Intergenic
1141035598 16:80622834-80622856 GTGATGAGGAGCTGAATAGCCGG - Intronic
1148451654 17:47782235-47782257 ATGCTGAGGAGTGGAATTGCTGG - Intergenic
1149002240 17:51769492-51769514 GTGATGGGGAGTGGGTTAAAGGG + Intronic
1150164185 17:62925731-62925753 GTGATGAACAGTGGATGTGCTGG + Intergenic
1150308971 17:64111924-64111946 ATGAGGAGCAGTGGATTATCAGG - Intronic
1152961949 18:85468-85490 GTGATGAGGAGGGGAGGAACTGG - Intergenic
1153224299 18:2886556-2886578 GTGTTGAGGAGTGGATGAAAGGG - Intronic
1155671024 18:28371304-28371326 GTGTTGATTAGTGGATTAGAGGG - Intergenic
1156614474 18:38767271-38767293 AAGATGAAGAATGGATTAGCTGG - Intergenic
1162913177 19:13860905-13860927 GTGGTGGGGAGGGGATTAGGGGG + Intergenic
1163216705 19:15884349-15884371 GTGAGGAGAAGTTGATTAACGGG + Intronic
1163502370 19:17684230-17684252 GTGATGAGGGGGAGATGAGCAGG - Intronic
1163774249 19:19208491-19208513 GTGGGGAGGAGTGGAGAAGCGGG + Intergenic
1163991162 19:21000336-21000358 GTGATGAGGAGAGGTTCACCAGG + Intergenic
1164420317 19:28085921-28085943 ATGATGAGGAGTGCAGTAACTGG - Intergenic
1165577397 19:36832667-36832689 GAGTTCAGGAGTGGCTTAGCTGG - Intronic
926284126 2:11473923-11473945 ATGATGAGGAGGGCAGTAGCGGG - Intergenic
926987497 2:18640080-18640102 GTGAGGAGGAATGGATCAGATGG + Intergenic
931960140 2:67473338-67473360 GTGAGGAGGAGTGGCTTGCCTGG - Intergenic
932325342 2:70855919-70855941 GTGCTGAGTAGTGGCTTAGCTGG + Intergenic
940921741 2:159315363-159315385 GAAATCAGGAGTGGCTTAGCTGG + Intergenic
945121604 2:206463023-206463045 GTGATGAGCAGAGGAATTGCAGG + Intronic
947717859 2:232350874-232350896 GGGGTGCGGAGTGGATGAGCTGG + Intergenic
948236197 2:236393050-236393072 ATGCTGAGGTGTGGAATAGCTGG + Intronic
948799636 2:240426246-240426268 GAGATGAGGAGGGAAGTAGCAGG + Intergenic
1169169380 20:3452246-3452268 GTGGTGGGGAGTGGATTTGTTGG + Intergenic
1169390174 20:5184276-5184298 GTGAGGATGACTGGATCAGCAGG + Intronic
1170320105 20:15086565-15086587 ATGATGATCACTGGATTAGCTGG - Intronic
1172806756 20:37617558-37617580 GTAAGGATGAGTGGATTAGTGGG + Intergenic
1174675749 20:52352525-52352547 ATGCTGAGGAGTAGAATAGCTGG + Intergenic
1175371772 20:58497146-58497168 GGGATGAGGAGGGGGTTGGCGGG + Intronic
1175942580 20:62544634-62544656 TTTATGAGGAGAGGTTTAGCTGG + Intergenic
1177255682 21:18659310-18659332 ATATTGAAGAGTGGATTAGCTGG + Intergenic
1177498996 21:21925960-21925982 GTCATGAGGAGAGGAGTCGCAGG + Intergenic
1178398417 21:32262856-32262878 GGGATGAGGAATGGATGTGCTGG - Intergenic
1179068395 21:38048518-38048540 GTGAACAGGGATGGATTAGCAGG - Intronic
1180079986 21:45482223-45482245 GTGATGATGAGTGGACTCACGGG + Intronic
1181806839 22:25380042-25380064 GCAATGAGGAGTGGATTAGCTGG - Intronic
1182255452 22:29034402-29034424 GTGATGGGGAGTGGGTTAAGGGG + Intronic
1203314806 22_KI270736v1_random:179299-179321 GTGGTGAGGAGTGGAGTGGAGGG + Intergenic
949385546 3:3497937-3497959 GTGGCGTGGAGTGGATTAGAAGG - Intergenic
952531006 3:34262013-34262035 GTGAGGAAGAGTGGATTTGTGGG - Intergenic
953496563 3:43392712-43392734 GGGATGAGGAGTGGAGAAGAGGG - Intronic
953915482 3:46917534-46917556 GGAATCAGGAGTGGCTTAGCTGG - Intergenic
960028752 3:113036900-113036922 GTGATGAGAAGTGGTTTGGTGGG - Intergenic
960336658 3:116426135-116426157 GTGATGAGCAGTGAATGAGATGG - Intronic
964471576 3:157062528-157062550 GTGATCACGAGTGTGTTAGCAGG - Intergenic
968032451 3:195512085-195512107 GTGATGAGGAGTGAGTTCTCAGG - Intergenic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
970623554 4:17851690-17851712 CTGACGAGGAGTAGAATAGCTGG + Intronic
971303022 4:25457291-25457313 GTAAGGAGGAGAGGCTTAGCAGG - Intergenic
971485687 4:27157658-27157680 GTGAGGAGGAGTCGAGGAGCCGG + Intergenic
971627185 4:28936554-28936576 GTGATGAAGACTGGGGTAGCTGG + Intergenic
971790009 4:31157121-31157143 GTGAGGAGGAGTGGAATATGAGG - Intergenic
972399783 4:38689962-38689984 GTGATGTGGTGTGGATGACCAGG + Intronic
973570757 4:52237076-52237098 GTGGTGAGGATTGGAATAGGTGG + Intergenic
981032824 4:140142980-140143002 GTGCAGAGGAGAGGATTAGTTGG - Intronic
986818711 5:11441614-11441636 GGGGTGGGGAGTGGATTACCAGG - Intronic
988460372 5:31430966-31430988 GTTATGAAGAGTTAATTAGCTGG - Intronic
993734107 5:91455535-91455557 GAAATCAGGAGTGGCTTAGCTGG - Intergenic
996794098 5:127325450-127325472 CTGATGATGAGTGAATTACCAGG + Intronic
1000156840 5:158560543-158560565 GTAATGAGGAGTGGCTCAGAGGG + Intergenic
1000749344 5:165074747-165074769 GTGAGGAGGGATGGATTATCGGG + Intergenic
1007013934 6:38443854-38443876 GAGGTGTGGAGTGGATTAGAGGG - Intronic
1009369943 6:62886948-62886970 GTGATTAGGACTGGAGTAGCCGG + Intergenic
1009486980 6:64236437-64236459 GTAATTAGGAGTGGAATTGCTGG + Intronic
1014982221 6:127958154-127958176 AAGATGAGGAGTGTAGTAGCTGG + Intergenic
1017766016 6:157608028-157608050 GTGATAAGCAGTGGATTTTCAGG - Intronic
1019098148 6:169603717-169603739 TTGATGAGAAGGGGCTTAGCTGG - Intronic
1019443984 7:1061412-1061434 GGGATGAGGAGGGGACTCGCTGG - Intronic
1020161731 7:5778281-5778303 GTGAAGAAGAGTAGTTTAGCTGG - Intronic
1022886063 7:34645139-34645161 ATGTTGAGGAGTGGTTTAGCTGG + Intergenic
1024771355 7:52727104-52727126 GTTATGAAGAGTGGTTTAACAGG - Intergenic
1032445254 7:131976738-131976760 GTAATAAGGAGTGGATTGGCAGG + Intergenic
1032707022 7:134429931-134429953 GTGGTGAGGAGTAAATGAGCTGG - Intergenic
1038028304 8:23612795-23612817 ATGATGAGGACTTGATTGGCTGG + Intergenic
1039269745 8:35867934-35867956 GTGAAGAGGAGTTGGTTAACAGG + Intergenic
1040846991 8:51854103-51854125 GTGATGTGAAGTGGCTTAGGTGG - Intronic
1041253990 8:55963222-55963244 GTGAGTGGGAGTGGATTTGCTGG + Intronic
1043197533 8:77316603-77316625 GTGATGAGAGGTGAATTAGTCGG - Intergenic
1044475426 8:92619504-92619526 CTGATGGGAAGTGGATTTGCTGG + Intergenic
1046090926 8:109501924-109501946 GTAGTGATGAGTGGCTTAGCTGG - Intronic
1046823749 8:118663810-118663832 GGGGTGATGAGTGGATTTGCAGG + Intergenic
1048245591 8:132794484-132794506 GTTATGATGAGTGGATTTACTGG + Exonic
1048853310 8:138664625-138664647 GTGAAGAGGAGTGGACCAACAGG - Intronic
1050770144 9:9188371-9188393 ATAATGAGGAGTGGAATTGCTGG + Intronic
1055894235 9:81157344-81157366 GGGATGCGGAGTGGATCATCTGG - Intergenic
1059458843 9:114416791-114416813 GAGATCAGGAGTGGATATGCAGG - Intronic
1059992736 9:119880508-119880530 GTGAAGAGGAGAGAATGAGCAGG - Intergenic
1062736195 9:138138649-138138671 GTGATGAGGAGGGGAGGAACTGG + Intergenic
1187926741 X:24257719-24257741 GTATTGAGGACTGTATTAGCTGG - Intergenic
1190116814 X:47630544-47630566 GTGATTAGGAGGGAATAAGCTGG + Intergenic
1197808034 X:130416042-130416064 CTGAAGAGGAGTGGAGGAGCAGG - Intergenic
1198483119 X:137059079-137059101 GTGGTTAGGAGTGGAGTAGGAGG + Intergenic
1201136081 Y:10991130-10991152 GTGGAGTGGAGTGGATTAGAGGG - Intergenic
1201598747 Y:15703267-15703289 GTAATGAAGAGTGAAGTAGCTGG + Intergenic