ID: 1084318621

View in Genome Browser
Species Human (GRCh38)
Location 11:68360617-68360639
Sequence TGACCTTCCCTCAGTGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 1, 2: 2, 3: 16, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084318611_1084318621 17 Left 1084318611 11:68360577-68360599 CCCCTTTATCTGTGACTGTGGCT 0: 2
1: 0
2: 2
3: 19
4: 358
Right 1084318621 11:68360617-68360639 TGACCTTCCCTCAGTGCTTCTGG 0: 1
1: 1
2: 2
3: 16
4: 217
1084318609_1084318621 27 Left 1084318609 11:68360567-68360589 CCTGTGCAGGCCCCTTTATCTGT 0: 1
1: 0
2: 0
3: 20
4: 180
Right 1084318621 11:68360617-68360639 TGACCTTCCCTCAGTGCTTCTGG 0: 1
1: 1
2: 2
3: 16
4: 217
1084318612_1084318621 16 Left 1084318612 11:68360578-68360600 CCCTTTATCTGTGACTGTGGCTG 0: 1
1: 1
2: 2
3: 29
4: 304
Right 1084318621 11:68360617-68360639 TGACCTTCCCTCAGTGCTTCTGG 0: 1
1: 1
2: 2
3: 16
4: 217
1084318613_1084318621 15 Left 1084318613 11:68360579-68360601 CCTTTATCTGTGACTGTGGCTGG 0: 1
1: 1
2: 1
3: 17
4: 258
Right 1084318621 11:68360617-68360639 TGACCTTCCCTCAGTGCTTCTGG 0: 1
1: 1
2: 2
3: 16
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084318621 Original CRISPR TGACCTTCCCTCAGTGCTTC TGG Intronic
900115708 1:1026995-1027017 GGGGCTTCCCTCAGTGCTGCAGG - Intronic
901071511 1:6521878-6521900 TGTCCTTCCTTCAGTGTTCCTGG - Exonic
904190487 1:28739221-28739243 TGAACTTCATTCAGTGCTGCAGG + Intronic
904354035 1:29926951-29926973 TGCCCCTCCCCCAGGGCTTCGGG - Intergenic
904423192 1:30407282-30407304 TCTCCTTCCATCAGTGCATCTGG - Intergenic
904864337 1:33565286-33565308 TGATTCTCCCTCATTGCTTCTGG + Intronic
906063213 1:42961647-42961669 TGGCCTTCCCTCAATCCATCTGG - Intergenic
908698160 1:66868574-66868596 TCCCCTGCCCTCAGTGCTCCTGG + Intronic
911027403 1:93448906-93448928 TCTCCCTGCCTCAGTGCTTCGGG + Intronic
911735318 1:101330682-101330704 TGACCTTCCTTCAGTTCCTTGGG - Intergenic
911895774 1:103433169-103433191 TGCTCTTCCCTCAGTGGTTTAGG - Intergenic
914374419 1:147061165-147061187 TGAGCTTCCCTCAGTGGTATAGG - Intergenic
916820992 1:168398694-168398716 TGACCTGCACTCTGTGCTCCTGG - Intergenic
919838398 1:201592284-201592306 TGTCTTTCCCTCTCTGCTTCAGG - Intergenic
920602709 1:207345859-207345881 TGTCATTTCCTCAGTGCTTTAGG + Intronic
922907982 1:229190283-229190305 TGTTCTTCCCTCAGTGATTGTGG - Intergenic
924209271 1:241748130-241748152 TGCCCTTCCCTCAGTGGCTTAGG - Intronic
924815105 1:247434661-247434683 AGCCCTTCCCTGAGTGCTTCTGG + Intronic
1062791195 10:307716-307738 TGCCCTTCCCTCCCGGCTTCTGG - Intronic
1063209041 10:3862093-3862115 TGAGCTGCCCTCAGCGCTCCTGG + Intergenic
1063351269 10:5357845-5357867 TTACCTTCCCTGTATGCTTCTGG - Intergenic
1063443766 10:6095090-6095112 TGATTTGGCCTCAGTGCTTCAGG + Intronic
1063484517 10:6406726-6406748 AGCCATTCCCTCAGTGCCTCAGG - Intergenic
1064152461 10:12876280-12876302 CCTCCTTCCCTCAGTGCTCCTGG - Intergenic
1067037367 10:42930572-42930594 TGACCTTCCGTCAGGGTTTAGGG + Intergenic
1068511213 10:57968265-57968287 TGACCTTCACTGAGTGCCTGGGG + Intergenic
1068875360 10:61990176-61990198 TCACCTTACCGCAGGGCTTCTGG - Intronic
1071347392 10:84705934-84705956 TGACATTTCTTCAGGGCTTCAGG - Intergenic
1073697066 10:105881568-105881590 AGACATTTCATCAGTGCTTCTGG - Intergenic
1075901848 10:126049502-126049524 TGACCTTCCCACATTGCATAGGG - Intronic
1076501580 10:130941065-130941087 TGACCTTAGCAAAGTGCTTCTGG - Intergenic
1076666380 10:132095299-132095321 TGGCCTTTCCCCAGTGCCTCTGG + Intergenic
1078673188 11:13383239-13383261 TGAATTTTCCTTAGTGCTTCTGG - Intronic
1079844595 11:25449130-25449152 TGACCTTCCCTCCTTTCTCCTGG + Intergenic
1083597038 11:63922891-63922913 AGCCCTTCCCTCAGGGCTGCTGG + Intergenic
1084318621 11:68360617-68360639 TGACCTTCCCTCAGTGCTTCTGG + Intronic
1085060947 11:73446534-73446556 TGACCTTCACTGAGTTCTTGGGG - Intronic
1085268890 11:75258077-75258099 TGATGTTTCCTCTGTGCTTCTGG + Intergenic
1085345100 11:75763528-75763550 TGTCCTTCTCTTAGTCCTTCAGG + Intronic
1085660727 11:78364203-78364225 TGTCCTTTCCACATTGCTTCTGG + Intronic
1085733709 11:79020982-79021004 TGCCCTTTCCTGAGTGCTTCAGG + Intronic
1087280476 11:96204067-96204089 TCTCCCTCCCTCAGTCCTTCAGG - Intronic
1087468780 11:98545578-98545600 TGGCCTTTTCTCAGTGCCTCTGG - Intergenic
1090895081 11:130964786-130964808 TGACCTTTTCCCAGTGCCTCTGG + Intergenic
1091511300 12:1129439-1129461 TGACCTTAGCTAAGGGCTTCAGG + Intronic
1092776671 12:11949872-11949894 AGCCCTTCCCTCCCTGCTTCTGG - Intergenic
1099072568 12:78064356-78064378 TGGCCTTTCCTCTGTGCTCCTGG + Intronic
1099130250 12:78819947-78819969 TTTCCTTTCTTCAGTGCTTCTGG + Intergenic
1100292738 12:93233413-93233435 AGACCTTCCCACAAGGCTTCAGG + Intergenic
1101351123 12:103930556-103930578 TGACCTTCGGTGAGTGATTCTGG + Exonic
1102143454 12:110636156-110636178 TGTGCTTCCCACAGTGCTTATGG + Intronic
1104364180 12:128162050-128162072 TCTCCTGCCCTCAGTGCTCCTGG + Intergenic
1104958407 12:132476927-132476949 TGAGCTGCCCTCAGTGCTTCCGG + Intergenic
1110405369 13:75144784-75144806 TGATGTTCCCTCATTGCTCCAGG + Intergenic
1110793528 13:79611866-79611888 TGGCCTTTCCCCAGTGCCTCTGG + Intergenic
1112239410 13:97666358-97666380 TCTCCTGCCCTCACTGCTTCTGG - Intergenic
1113124838 13:106965771-106965793 TCTCCTCCCCTCAGTGCTCCTGG - Intergenic
1113423865 13:110191908-110191930 TGTCCTTCCCTCAGGGTCTCTGG - Intronic
1117112686 14:52475234-52475256 TGGCCTTCTCTGAGTGCCTCTGG - Intronic
1119945095 14:78685086-78685108 AGGCCTTTCCTCAGTGCTTTAGG + Intronic
1120247685 14:82026008-82026030 TGACCTTCCTGCAGTTCTTCAGG - Intergenic
1120509517 14:85396546-85396568 TGGCCTTCCCACTGTGCTTGTGG - Intergenic
1121447275 14:93987171-93987193 TGCCCTGCCCTCAGGGCCTCTGG + Intergenic
1121637951 14:95466411-95466433 AGACCCTCCCTCAGTCCTACTGG + Intronic
1122427600 14:101620834-101620856 TGACTTTCACTCTTTGCTTCTGG - Intergenic
1125616889 15:41022450-41022472 GGCCCCTCCCTCAGTTCTTCTGG - Intronic
1126179556 15:45771641-45771663 AAACCTGCCCTCAGTGCCTCTGG + Intergenic
1126341563 15:47646160-47646182 TAACCTTGCCTCAGTCTTTCTGG + Intronic
1128408841 15:67372377-67372399 TGACCTTCTCTCAGTGTTAGAGG + Exonic
1128525958 15:68412428-68412450 TGTCATTCCCTGAGTGATTCAGG - Intronic
1130034627 15:80346435-80346457 TGTCCTTCCTTCTGTCCTTCAGG + Intronic
1132750921 16:1457278-1457300 TGACCTTCCCTGAGAGATCCCGG + Exonic
1134194363 16:12147677-12147699 TGACTTTCCCTCTTTGCCTCCGG + Intronic
1135079016 16:19418074-19418096 TTACCTGCCCTCAGTTCTACAGG - Intronic
1137978042 16:53047525-53047547 TGGCCTTTTCTCAGTGCTTTTGG + Intergenic
1138863236 16:60785344-60785366 TCAACTTTCCTCAGTTCTTCAGG + Intergenic
1139461717 16:67127899-67127921 TTACCTTCCCCCAGTGTTTCTGG - Intronic
1139587212 16:67911757-67911779 TCACCTTCCCTGACAGCTTCTGG + Intronic
1140036835 16:71377692-71377714 AGAACTTCCTTCTGTGCTTCAGG + Exonic
1140875971 16:79152877-79152899 TGCTCTTCCCTCAGTGCAACTGG - Intronic
1141574818 16:84957109-84957131 TGACCTTCCTTCAGTGTTGGGGG + Intergenic
1142284393 16:89165793-89165815 TGTCCCTCCCTCAGTGCCCCAGG - Intergenic
1144462576 17:15469717-15469739 GGACTTGACCTCAGTGCTTCTGG + Intronic
1145237240 17:21216824-21216846 AGACCTACCTCCAGTGCTTCTGG - Intergenic
1147338832 17:39742127-39742149 TGTCCTTCCCCAAGGGCTTCAGG + Intronic
1147407844 17:40226074-40226096 TGACCTACTTTCTGTGCTTCTGG + Intronic
1147923634 17:43933539-43933561 CTACCTGCCCTCAGTGCATCTGG - Intergenic
1150296049 17:64008077-64008099 TGCCCTTCCCTCACTGCTGAGGG + Intronic
1150613003 17:66748886-66748908 TGCCCTTCCCTCTCAGCTTCAGG + Intronic
1151705616 17:75765374-75765396 TGTCCTTCCCTCTGGACTTCGGG + Exonic
1151983909 17:77529734-77529756 TGTCCTTCCCGCAGGGCTTTAGG + Intergenic
1152430966 17:80248154-80248176 TGACCTTCCTGCTGTGCTTCTGG + Exonic
1152932016 17:83114801-83114823 TCCCTCTCCCTCAGTGCTTCTGG - Intergenic
1160342789 18:78103932-78103954 TGACTTTCCCTCACTGTGTCTGG + Intergenic
1160700844 19:506635-506657 GGATCTTCCCTCACTGCTTTCGG - Intergenic
1160871227 19:1278802-1278824 TGTCCTTCCCTCATGGCTGCTGG - Exonic
1160875401 19:1294309-1294331 TCCCCTTCCCTCACTGCCTCGGG - Intronic
1163621505 19:18363571-18363593 TGAGCGTCCCTCAGTGTTTGTGG - Exonic
1163775359 19:19214137-19214159 TCACCTTCACTCAGTGCTAACGG + Intronic
1165287165 19:34851953-34851975 TGATCTTCCCTCATTGCAACAGG + Intergenic
1166372529 19:42310142-42310164 TGACCTTGCCCTGGTGCTTCGGG + Exonic
1166671287 19:44710885-44710907 TGCCCCTCCCGCAGTGCTCCAGG + Intergenic
1167169165 19:47819843-47819865 TGACCTTCCTTCCCTGCTGCAGG + Intronic
1168365569 19:55784111-55784133 TGACATTGCCTCAGTGAGTCTGG - Intergenic
924974654 2:161510-161532 TCACCCTCACGCAGTGCTTCAGG + Intergenic
925479214 2:4251386-4251408 TGGCCTTTCCCCAGTGCTTCTGG + Intergenic
925619874 2:5781853-5781875 TGCCCTTTCCTCAGTGTTGCTGG - Intergenic
929435954 2:41928543-41928565 TGAGTTTTCCTCAGTGATTCTGG + Intergenic
930842922 2:55867758-55867780 AAGCTTTCCCTCAGTGCTTCAGG - Intronic
934549779 2:95251647-95251669 TGAGCTTCCCCAAGAGCTTCTGG + Intronic
935914505 2:107934992-107935014 TGACCTTCCTTCTCTCCTTCAGG - Intergenic
937342381 2:121099489-121099511 TGTCCTGGCCTCAGTGCTGCAGG - Intergenic
937541912 2:122966137-122966159 TAACCTTCCCCCACTGCTTCAGG + Intergenic
937662959 2:124451956-124451978 TGGCCTTTTCTCAGTGCCTCTGG - Intronic
939426520 2:142045218-142045240 TACCATTCCCACAGTGCTTCAGG + Intronic
939695120 2:145313794-145313816 AGATCTTCCCACAGTACTTCTGG - Intergenic
940396735 2:153198451-153198473 TCTCATTCCTTCAGTGCTTCAGG + Intergenic
941385126 2:164842111-164842133 TTTCCTTCCCCCAGGGCTTCGGG + Intronic
943141404 2:183987133-183987155 TCTCCTGCCCTCAGTGCTCCTGG - Intergenic
944310809 2:198231929-198231951 TGACCTGCCCTTATTGCTTTTGG + Intronic
945874242 2:215261451-215261473 TTACCTTTCCTGAGTGCTTAAGG + Intergenic
948392449 2:237622312-237622334 TCACCTTCACTAAGTGCTACTGG - Intergenic
948633556 2:239318225-239318247 TCACCTTCACTGAGAGCTTCCGG + Intronic
948945551 2:241217462-241217484 TGCCCTGCGCTCCGTGCTTCTGG - Intronic
1170483773 20:16794489-16794511 TGACCTTTGCCCAGTGCCTCTGG + Intergenic
1170655197 20:18280133-18280155 GGATCTGCCCTCAGTGCTACTGG + Intergenic
1171419247 20:25006804-25006826 TGACCTTCACTCTGTGGTTGGGG - Exonic
1172980557 20:38938325-38938347 ACACGTTCCCTCAGTGCTACTGG - Intronic
1175140742 20:56858940-56858962 TGACATTCACTCAGGGCTTAGGG - Intergenic
1175478846 20:59297303-59297325 TGACCTTCCATCAGAGATTATGG + Intergenic
1177846936 21:26300478-26300500 TTACCTTCTATCAGTTCTTCTGG + Intergenic
1178980680 21:37261773-37261795 TGACATTCCCACAGTGCATGAGG + Intronic
1180063950 21:45403884-45403906 AGTCCTTCCCTGAGTGCTTGCGG - Intergenic
1180157012 21:45982781-45982803 TGACCTTCCTCCTGTGCTTCTGG + Intronic
1181646654 22:24234910-24234932 TGACCAGCCCTCAGTGCTAAAGG - Intronic
1181689222 22:24549113-24549135 GGACCTTCCCACAATCCTTCAGG + Intronic
1181806626 22:25378634-25378656 TGACCTTCCCTTAGTGCTTCTGG - Intronic
1185156701 22:49197346-49197368 TGACATTCCCCCAGTTCTCCAGG - Intergenic
949570984 3:5292915-5292937 TGACTTTTCCTTAGTGCCTCTGG - Intergenic
950077385 3:10196652-10196674 TGCCCTTACGTCAGTGGTTCTGG + Intronic
951967056 3:28398852-28398874 TGGCCTTTTCTCAGTGCTTCTGG - Intronic
955948197 3:64215326-64215348 CACCCTTCCCTCAGTACTTCAGG + Intronic
956934361 3:74082957-74082979 TCAATTTCCCTCAGTGCTTTTGG - Intergenic
958685117 3:97383330-97383352 TGCCCTTCATTCAGTGTTTCCGG - Intronic
958800925 3:98754753-98754775 TGATCTTGACTCAGTGCTTATGG - Intronic
959145186 3:102535502-102535524 TTACCTTTCCTCATTGATTCTGG + Intergenic
960968007 3:123118885-123118907 TGTCCTTCCCACTATGCTTCCGG - Intronic
962462117 3:135623976-135623998 TGACCTCCCCTCCCTGCTCCAGG + Intergenic
964921649 3:161903896-161903918 TCATTTTCACTCAGTGCTTCAGG - Intergenic
965857461 3:173105623-173105645 TGAACTTTCCCCTGTGCTTCCGG + Intronic
966933384 3:184690308-184690330 TCACCTTCCTTCACTGCTCCGGG - Intergenic
968454941 4:692960-692982 AGTCCTTCCCCCAGGGCTTCGGG - Intergenic
969612079 4:8232950-8232972 TGGCCTGCCCCCAGAGCTTCTGG - Intronic
969696347 4:8737299-8737321 TGACCTCCCCTCCAAGCTTCCGG - Intergenic
970166092 4:13240077-13240099 TGACCTTTCCTCAGTGCTTGAGG - Intergenic
970968444 4:21953887-21953909 TTACCTTCCCACAGTTCTGCAGG - Intergenic
971111831 4:23593538-23593560 TCTTCTTCCCTCAGTGCTTCTGG - Intergenic
971231207 4:24801086-24801108 TTAACTTCCCTGAGTGATTCTGG - Intergenic
972930710 4:44068607-44068629 TGATTTTCTCTCACTGCTTCAGG - Intergenic
973552779 4:52051972-52051994 TGCCCTTGTCTCAGAGCTTCGGG + Intronic
975118821 4:70706259-70706281 GGTCCTTCCCTCATCGCTTCAGG - Intronic
975491015 4:74988914-74988936 TGCCCTTTCCTCAGTGGTTTTGG - Intronic
976694781 4:87907822-87907844 TCATCTTCCCTCTGTGCATCAGG + Intergenic
976710315 4:88063709-88063731 AGACCTGCCCTAAGTTCTTCTGG - Intronic
978836061 4:113150704-113150726 TGAACTTCCCATAATGCTTCAGG - Intronic
985240884 4:187929804-187929826 TGGCCTTCTCCCAGTGCCTCTGG + Intergenic
985287757 4:188354378-188354400 TGATCTTTCCACTGTGCTTCTGG + Intergenic
985544809 5:504316-504338 TGACCTGCCCTCCTTGCTTCAGG + Intronic
985692202 5:1319642-1319664 TGCCCTTCCCTCAGGGCCTGGGG - Intronic
987067588 5:14304505-14304527 AGACCTTCCCTCAGAGCTGCAGG + Exonic
991666711 5:69006614-69006636 TTTCCTTCCCTCATAGCTTCTGG - Intergenic
995462129 5:112414633-112414655 TGTCCCTCCCTAGGTGCTTCTGG - Intronic
995730284 5:115232230-115232252 TCACCTTCACTTAGTTCTTCTGG - Intronic
1000536563 5:162485600-162485622 TGACCCTCCATTAGTGCTGCTGG - Intergenic
1001669643 5:173463175-173463197 TTCCCTAGCCTCAGTGCTTCGGG - Intergenic
1002938546 6:1696125-1696147 TGATCTTGGCTCAGTGCTCCAGG + Intronic
1005969738 6:30751694-30751716 TGACCTTGCCTTGGTGCTCCCGG - Intergenic
1006409821 6:33866569-33866591 TCTCCTTCCCTCAGTTCTTGAGG + Intergenic
1007000804 6:38310606-38310628 TGACCTACATTCAGTGCTTTTGG + Intronic
1007360717 6:41353334-41353356 TTCCCTTCCCTCAGTTCCTCAGG - Intergenic
1007396978 6:41583498-41583520 TAACCTTCCCTTCCTGCTTCCGG + Intronic
1008413256 6:51207994-51208016 TGACTTTCTTTCATTGCTTCTGG + Intergenic
1009626529 6:66143754-66143776 TGAACTTCCCCCAGGGATTCTGG - Intergenic
1010766156 6:79778739-79778761 GGCCCTTCCATCTGTGCTTCTGG - Intergenic
1010944670 6:81959919-81959941 TGAGCTTCACTCAGTGGTTATGG + Intergenic
1012103313 6:95120136-95120158 TGACATTCCCTCAGCTCTTGAGG + Intergenic
1013112405 6:107074552-107074574 GGACTTTCCCACAGTGCCTCAGG + Intronic
1014116560 6:117674118-117674140 TGCCCAGCCCTCAGTTCTTCAGG + Intergenic
1014132415 6:117849394-117849416 TGACTTTTCCTCAGTGATTTTGG + Intergenic
1016030776 6:139335411-139335433 TGACCTTGACTCATGGCTTCAGG - Intergenic
1016209411 6:141510205-141510227 TTCCCTTCCCTCTGTGATTCAGG + Intergenic
1017741331 6:157409331-157409353 TGACCTCCCATCAGGTCTTCTGG + Intronic
1017770548 6:157640692-157640714 TGACCCTCCCTCAGTGGGGCTGG - Intronic
1018860600 6:167708440-167708462 GGATCTTCCTGCAGTGCTTCAGG - Intergenic
1019128674 6:169858511-169858533 TGACCTGGCCGCAGAGCTTCAGG + Intergenic
1021148523 7:17120067-17120089 TCACATTTCCTCAGTGTTTCTGG + Intergenic
1027711818 7:81613683-81613705 TCACCTTCACTAAGTTCTTCTGG + Intergenic
1028339950 7:89706225-89706247 TGAACTTTCCACCGTGCTTCTGG - Intergenic
1029303816 7:99604314-99604336 TCTCCTTCCCTCTGTGCTGCAGG + Intronic
1030783406 7:113629105-113629127 TCACCTTCACTCAGTTCCTCAGG + Intergenic
1031181826 7:118429174-118429196 TGTCTTTCCCTCAGTGTTCCTGG + Intergenic
1031757216 7:125660199-125660221 TGACCTTTCCACAGTGCATGGGG - Intergenic
1032922730 7:136567448-136567470 TGCCCTTCTCCCAGTGCCTCTGG + Intergenic
1034514062 7:151560172-151560194 TGACGTTCCCTCTATGTTTCTGG + Intronic
1034599995 7:152241544-152241566 AGACCTTTCCTTAGTGCTCCCGG + Intronic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1037776855 8:21841189-21841211 TCACCTTCCTTCAGGGCTCCTGG - Intergenic
1037781352 8:21871375-21871397 TGACACCCCCTCAGTACTTCGGG - Intergenic
1037985294 8:23287213-23287235 TGCCCTTAGGTCAGTGCTTCCGG + Intronic
1040490683 8:47919018-47919040 TCACTTACCCTCAGTGCTTCAGG - Intronic
1041379486 8:57239017-57239039 TCAACTTCCCTCACTGCTCCTGG + Intergenic
1042225316 8:66510746-66510768 TGGCCTTCCCTCTGTGCATGTGG + Intronic
1045006600 8:97921621-97921643 TGACCAGCTCTCAGTGCTTAAGG - Intronic
1045520221 8:102896876-102896898 TGTCCCTCCCTCAGTGGTCCTGG - Intronic
1047006601 8:120626818-120626840 TTACCTTCCCTAAGTTCTTCTGG + Intronic
1048195408 8:132328095-132328117 GTACCTTCCCTCACTGGTTCAGG - Intronic
1049220001 8:141424838-141424860 TGCCCTTCCCTGGGGGCTTCAGG + Intronic
1049455308 8:142683507-142683529 TGACCCACCCTCAGAGCTCCAGG - Intergenic
1052358818 9:27531924-27531946 TGCCATTACCTCAGTGCTTAGGG - Intergenic
1053053764 9:34981462-34981484 TGACCTTCCCTCTTGGCTTTTGG - Exonic
1055741565 9:79395332-79395354 TGACCTTCTCTTGGTGGTTCTGG - Intergenic
1055902519 9:81257562-81257584 TGACCCTCCCTGACAGCTTCAGG - Intergenic
1056266818 9:84905408-84905430 TGTCCTTCCCTCTATCCTTCAGG - Intronic
1056935958 9:90914854-90914876 TTTCCTTCCCTCTGTCCTTCTGG - Intergenic
1057055988 9:91961215-91961237 TGTCCTTCCCACACTGCATCTGG - Intergenic
1059459621 9:114421400-114421422 TGATTTGCCCTCAGGGCTTCGGG + Intronic
1061684200 9:132261144-132261166 TGTCCCTCCACCAGTGCTTCTGG + Intergenic
1061802170 9:133118717-133118739 TCACCTGACCTCAGGGCTTCTGG + Intronic
1188515582 X:30982001-30982023 TTACCTTCCCTGAGTTTTTCTGG - Intergenic
1192929546 X:75791701-75791723 TGGCCTTTCCCCAGTGCTTCTGG - Intergenic
1193085010 X:77441179-77441201 TGGCCTGCTCTCAGTGCTGCTGG - Intergenic
1193628744 X:83853590-83853612 TGAATTTCCCACTGTGCTTCGGG - Intergenic
1196581255 X:117381727-117381749 TCTCCTGCCCTCAGTGTTTCTGG - Intergenic
1199044553 X:143153814-143153836 TGACCTTCCCTCAGTTGTGAGGG + Intergenic
1200359821 X:155592842-155592864 TGAACTTCCCACTGTGCTTCTGG - Intronic
1201264700 Y:12194444-12194466 TGACCTTCTGTCAGTCCTCCAGG + Intergenic
1201687034 Y:16716392-16716414 TGATCTGCCCTCTGTGCTGCTGG - Intergenic