ID: 1084320832

View in Genome Browser
Species Human (GRCh38)
Location 11:68372629-68372651
Sequence CCTCCAAACCCCATGGAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084320832_1084320840 11 Left 1084320832 11:68372629-68372651 CCCCGCTCCATGGGGTTTGGAGG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1084320840 11:68372663-68372685 GGTTGTGCTGAGCAGCGTGATGG 0: 1
1: 0
2: 1
3: 9
4: 126
1084320832_1084320839 -10 Left 1084320832 11:68372629-68372651 CCCCGCTCCATGGGGTTTGGAGG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1084320839 11:68372642-68372664 GGTTTGGAGGAAGGCTGTGTGGG 0: 1
1: 0
2: 2
3: 36
4: 318
1084320832_1084320843 26 Left 1084320832 11:68372629-68372651 CCCCGCTCCATGGGGTTTGGAGG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1084320843 11:68372678-68372700 CGTGATGGTGCAGGCTGTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 150
1084320832_1084320842 25 Left 1084320832 11:68372629-68372651 CCCCGCTCCATGGGGTTTGGAGG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1084320842 11:68372677-68372699 GCGTGATGGTGCAGGCTGTCTGG 0: 1
1: 0
2: 1
3: 17
4: 118
1084320832_1084320841 17 Left 1084320832 11:68372629-68372651 CCCCGCTCCATGGGGTTTGGAGG 0: 1
1: 0
2: 1
3: 4
4: 116
Right 1084320841 11:68372669-68372691 GCTGAGCAGCGTGATGGTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084320832 Original CRISPR CCTCCAAACCCCATGGAGCG GGG (reversed) Intronic
901956921 1:12793100-12793122 CTTCCAAACACCAAGGAGGGAGG - Intronic
901964914 1:12858782-12858804 CTTCCAAACACCAAGGAGGGAGG - Intronic
901980315 1:13029236-13029258 CTTCCAAACACCAAGGAGGGAGG - Intronic
901989135 1:13098179-13098201 CTTCCAAACACCAAGGAGGGAGG + Intergenic
901992678 1:13128588-13128610 CTTCCAAACACCAAGGAGGGAGG - Intergenic
902001772 1:13199695-13199717 CTTCCAAACACCAAGGAGGGAGG + Intergenic
902020998 1:13345420-13345442 CTTCCAAACACCAAGGAGGGAGG + Intronic
902980781 1:20121442-20121464 CCTCCATACCAGATGGAGGGTGG - Intergenic
903235642 1:21948967-21948989 CCTCCAAACACCGTGGAACCTGG + Intergenic
904978087 1:34473693-34473715 CCTCCACACCCATTGGAGCCAGG + Intergenic
906295848 1:44648736-44648758 CGTCCAAACTCCAGGGAGAGGGG - Intronic
907312698 1:53548133-53548155 CCCCCAAGTCCCATGGAGTGCGG - Intronic
912695022 1:111834996-111835018 CCTCCAAGCCCCAGGGATCCAGG - Intronic
914901388 1:151713053-151713075 CCTTCAAACCCCTTGGATGGGGG + Intronic
915368363 1:155328080-155328102 CCTCCAAACCCCAGGGTTCTTGG + Intronic
918564118 1:185906582-185906604 CCTTCAAACCCAATGCAGAGAGG - Intronic
919838776 1:201594387-201594409 CCTGCAGACCCCATGCAGCCTGG - Intergenic
920206789 1:204298141-204298163 CTTCCAAATCCCATAGAGCCTGG + Intronic
921362086 1:214339641-214339663 CCTCCAAACCCCATTGTACAGGG + Intergenic
922862804 1:228833949-228833971 TCTCCAAACGCGATGGAGAGTGG - Intergenic
924282595 1:242453088-242453110 CCTCCTAACACCATCGAGCTGGG - Intronic
1063190226 10:3686772-3686794 TGTCCAAAGCCCATGGAGCAAGG - Intergenic
1069705962 10:70459101-70459123 ACTCCAAGCCCCAGGGAGCCCGG + Intergenic
1072607770 10:96998832-96998854 CCTCCCAGCCCCATGGCGCCAGG + Exonic
1077857001 11:6137531-6137553 CCTCCAAACATCATGGATCTAGG + Intergenic
1081856029 11:46304596-46304618 CCCCCAAACCCCATGAAGGCAGG + Intronic
1083782356 11:64925038-64925060 CCCCCAAACCTCATGGGGTGGGG - Intronic
1084320832 11:68372629-68372651 CCTCCAAACCCCATGGAGCGGGG - Intronic
1085127515 11:74011672-74011694 CCTCACAACCCCATGAAGCTGGG + Intergenic
1087252867 11:95923706-95923728 CCTCCACGCCCCAGGGAGGGAGG + Intronic
1089787990 11:120921733-120921755 CCTCCCCACCCCATGGAGAGAGG - Intronic
1091629472 12:2148812-2148834 CCTCCAGACCGCAGGGAGGGAGG - Intronic
1101118327 12:101553573-101553595 ACTCCAAAGCCCATGGACAGGGG + Intergenic
1102026538 12:109717048-109717070 CCCCCAAACCCCATGGGAGGAGG - Intronic
1106054996 13:26229305-26229327 CCGCCCAACCCCAGGGAGCCTGG - Intergenic
1110860359 13:80340346-80340368 CGTCCCAACCCCCTAGAGCGCGG + Intronic
1115941473 14:38615284-38615306 CCTACAATCTCCATGGAGAGAGG + Intergenic
1117748699 14:58898352-58898374 CATCCAAACACCATAGAGGGAGG + Intergenic
1119377262 14:74204664-74204686 CCTCTGAGCCACATGGAGCGCGG - Intergenic
1121089595 14:91171825-91171847 TCCCCAGACCCCATGGAGCACGG - Intronic
1121449561 14:93998595-93998617 CCTCCCATCCCCATGGGGTGAGG - Intergenic
1122066471 14:99177153-99177175 CCTCCAGACCCCAGGGAAGGCGG + Intronic
1122821044 14:104345264-104345286 CCTCCAGACACCATGGAGAGGGG + Intergenic
1127720132 15:61691282-61691304 TGTCCAAACCCCAGGGAGCCAGG + Intergenic
1128582456 15:68819189-68819211 ACTCCCAACTCCATGGAGCTCGG + Intronic
1129459234 15:75691946-75691968 CTTCCACACCCCATGGGGAGAGG - Intronic
1130385116 15:83404311-83404333 CTCCCAAACCCCATGCAGAGCGG - Intergenic
1130637886 15:85642546-85642568 CCCCCTAACGCCATGGGGCGGGG - Intronic
1133557148 16:6916366-6916388 CATCCAAACCCCATGCACAGAGG - Intronic
1140540746 16:75754502-75754524 CCTCTGAACCCCAGGGATCGAGG - Intronic
1142863224 17:2776191-2776213 CCTCCAGATCCCAGGCAGCGGGG + Intergenic
1142885982 17:2912278-2912300 CCCCCCAACCCCAGGGAGAGAGG - Intronic
1144740843 17:17581392-17581414 CCTCCAGACCCCAGGCAGTGAGG + Intronic
1146359048 17:32159416-32159438 CCTGCCAGCTCCATGGAGCGCGG - Intronic
1147875334 17:43616957-43616979 ACTCCTCACCCCATGGAGAGGGG - Intergenic
1149170087 17:53799336-53799358 CCTCCAAACCACAGGGGGAGAGG + Intergenic
1149355921 17:55839470-55839492 GGTCCCAACCCCATGGAGCCTGG + Intronic
1151380865 17:73724870-73724892 CTTCCCGACCCCATGGAGGGAGG + Intergenic
1151691234 17:75686814-75686836 CCTCCAAACCCAATGCTGCATGG - Intronic
1151913945 17:77103817-77103839 CCTCATAACCCCATGGAGCCGGG - Intronic
1152512548 17:80800076-80800098 CCCCCAAACCCCAGACAGCGGGG - Intronic
1152515271 17:80819916-80819938 TGTCTGAACCCCATGGAGCGAGG + Intronic
1152659236 17:81534803-81534825 CCTCCACACCCCCAGGAGCCAGG - Intronic
1152660899 17:81541443-81541465 CCCCCACACCCCTTGGAGCAGGG + Intronic
1152840984 17:82568071-82568093 CCTCCAGCCCCCGGGGAGCGGGG + Exonic
1156347319 18:36269434-36269456 CCTCCAAATCCTATCGAGGGAGG + Exonic
1160006646 18:75073371-75073393 CCTCCCAGCAGCATGGAGCGTGG + Intergenic
1160605472 18:80046554-80046576 CCTCCCAACCCCCTGGAGCTGGG + Intronic
1163276339 19:16286623-16286645 CCTCCACACCCCATGGCCCAGGG - Intergenic
941870365 2:170378235-170378257 CCTCCAAACCCCATAGCCAGAGG + Intronic
1174841289 20:53903794-53903816 CCACCAAACACCATGCAACGAGG + Intergenic
1179069089 21:38054885-38054907 CCTCCATCCCCCATGGTGAGGGG + Intronic
1179251404 21:39674149-39674171 CATCCACACCCCAAGGAGAGAGG - Intergenic
1179341649 21:40516494-40516516 CCTCACAGCCCCATGGAGAGAGG - Intronic
1179988712 21:44934773-44934795 CCCCCAACCCCCAGGGAGCTGGG + Exonic
1179995650 21:44972876-44972898 CCTCCATGTCCCATGGAGCCAGG + Intronic
1180616911 22:17134433-17134455 CCTTCACTCCCCAGGGAGCGTGG - Intergenic
1181432904 22:22893936-22893958 CCTCCAGGCCCCATGGAGAAAGG - Intronic
1181804657 22:25367459-25367481 CCTCCAAACCCTGTGTAGTGGGG + Intronic
1184532449 22:45064873-45064895 CCTCCAGATCCCATGAAGAGGGG + Intergenic
950538306 3:13594625-13594647 CCTCCAGAGCCCACGGAGCCAGG - Intronic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
952919171 3:38273185-38273207 CCCACAAACCCCATGGGGTGGGG + Intronic
969592033 4:8127558-8127580 CCTGGCACCCCCATGGAGCGTGG + Intronic
974551458 4:63380087-63380109 CTGCCAAGCCCCAAGGAGCGTGG - Intergenic
985511319 5:315753-315775 CCTCCCATCCCCAGGGAGCCTGG - Intronic
985512912 5:322118-322140 CCGCCCAGCCCCAGGGAGCGCGG - Intronic
985995135 5:3593510-3593532 CCTCAAAACACCAGGGAGCTGGG - Intergenic
993495426 5:88603252-88603274 CCTTCAGACCCCATGGGGCCGGG - Intergenic
997214008 5:132095559-132095581 CCTCCAAAGGCCCTGGAGCTGGG - Intergenic
998016063 5:138733343-138733365 CCTCCAAAGCTCAGGGAGCAAGG + Intronic
1004129464 6:12905111-12905133 GGTCCCAACCCCATGGAGCCTGG + Intronic
1007074820 6:39059769-39059791 CCTCTAGACCCCAGGGAGCCAGG + Intronic
1007385774 6:41519451-41519473 CCTCCAACCCCCATCCAGCAGGG + Intergenic
1009403374 6:63282541-63282563 CCTCCAGACCCCAAGAAGCATGG + Intronic
1010768758 6:79804974-79804996 CATCCAAGCCCCGTGGAGTGTGG - Intergenic
1018714524 6:166521384-166521406 CCTCCAGACCCACTGGAGCAGGG - Intronic
1019408789 7:897770-897792 CCTCCAAACCTCAGGGAGCGAGG + Intergenic
1023576498 7:41634024-41634046 CATCCAAACCCCAGAGAGAGTGG + Intergenic
1024262465 7:47582371-47582393 CCTCCAGACCACTTGGAGCCTGG - Intronic
1024561694 7:50650080-50650102 CCTCCAAACACCAAGCAGCCTGG + Intronic
1026876430 7:73881664-73881686 CCTCCAAGCCCCAAGGTGGGGGG + Intergenic
1033106103 7:138525945-138525967 CCACTAACCTCCATGGAGCGGGG + Intronic
1033595558 7:142855764-142855786 ACTCCAATCCCCTTGGAGCTGGG + Intronic
1034275857 7:149823582-149823604 CCTTCAAACCCCTTGGAACTCGG + Intergenic
1037892539 8:22630927-22630949 CGTCCAAACCACTTGGAGAGCGG - Intronic
1039762156 8:40589589-40589611 CCTACAAACCCTATGGAGTCTGG - Intronic
1040471521 8:47738506-47738528 ACTCCCAACCCCGAGGAGCGAGG - Exonic
1044784348 8:95778673-95778695 TCTTCAAACCCCATGGTGTGAGG - Intergenic
1049332821 8:142064249-142064271 CGTCCACACGCCAAGGAGCGAGG - Intergenic
1051655821 9:19380471-19380493 GCTCCAAAACCCAGGCAGCGTGG - Intergenic
1052390873 9:27877762-27877784 ACTCCAAACCTCATGGACCCTGG + Intergenic
1055305398 9:74924061-74924083 CCCCCCACCCCCATGGAGCTGGG - Intergenic
1061252762 9:129436383-129436405 CCCCCAAACCCCTCAGAGCGAGG + Intergenic
1061809802 9:133155656-133155678 CCTCCAAACTCCAGTGAGCTAGG + Intronic
1062101289 9:134730056-134730078 CCCCCAAGCCCCATGGATGGGGG + Intronic
1185800242 X:3004086-3004108 TCTCTAAGCCACATGGAGCGGGG - Intergenic
1188526208 X:31090576-31090598 CCTTCAAAATCCATGGAGCCAGG - Intergenic
1192214097 X:69146061-69146083 CCTCCAAACCCCATGCCCTGTGG + Intergenic
1192522834 X:71816494-71816516 CTTCCGTACCCCATGGAGAGTGG + Intergenic
1196205778 X:112937756-112937778 CCTCCAATTCCCATGTAGCTGGG - Intergenic
1200068553 X:153516902-153516924 CCTCCACAGCCCCTGGAGCTGGG + Intergenic