ID: 1084322298

View in Genome Browser
Species Human (GRCh38)
Location 11:68380347-68380369
Sequence CTGTGTTGACTGAGGCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084322293_1084322298 5 Left 1084322293 11:68380319-68380341 CCATAAATGAAGTTTTGTTTGCT 0: 1
1: 0
2: 0
3: 39
4: 403
Right 1084322298 11:68380347-68380369 CTGTGTTGACTGAGGCAGGCTGG 0: 1
1: 0
2: 5
3: 33
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084322298 Original CRISPR CTGTGTTGACTGAGGCAGGC TGG Intronic
901050471 1:6423739-6423761 CAGTGCTGACTGTGCCAGGCTGG + Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901776941 1:11566595-11566617 CTGTGCTGGCGGAGGGAGGCTGG - Intergenic
902842883 1:19086449-19086471 CTTTGCTGACTCAGGTAGGCAGG + Intronic
903227435 1:21901821-21901843 CTGTGGTGACCGTGGCAGGGAGG - Intronic
903928441 1:26848594-26848616 CTGTGTTGTCTGAGGGAAGGAGG - Exonic
905171896 1:36114621-36114643 CTGTTCTGCCTGAGGGAGGCAGG - Intronic
905273773 1:36804123-36804145 CTTTGTTGACTAAGGCTTGCTGG + Intronic
905502623 1:38451715-38451737 CAGTGATGACTCAGGCAGGCTGG - Intergenic
905562789 1:38940768-38940790 CTGAGTTAACTGAGGCACGGCGG - Intronic
905876653 1:41435884-41435906 CTGTGTGGGCTGAGGGTGGCAGG - Intergenic
906403333 1:45521699-45521721 CTGTGATGCGTGAGGCAGCCGGG - Exonic
908559679 1:65293086-65293108 CTGAGCTGACTGAGGCAGAGGGG - Intronic
909135019 1:71787071-71787093 CTGGGATGACTTAGGCAGTCAGG - Intronic
909512808 1:76474103-76474125 ATGTGTTGACTGAGGCAAGCTGG - Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
913323910 1:117609862-117609884 CTTGGTGGACCGAGGCAGGCAGG + Intronic
916474255 1:165153570-165153592 CTGTCTTGGCTCAGGCAAGCAGG + Intergenic
917111962 1:171557764-171557786 CTGTGATGACTGGGGCAGCTGGG - Exonic
917656360 1:177130213-177130235 CTTTGTTGACTGAGACAAGGTGG - Intronic
920072310 1:203311254-203311276 CTGTGTTGAGTGAGGAGGGTAGG + Intergenic
924852654 1:247845878-247845900 CTTTCTTGAGTGGGGCAGGCTGG - Intergenic
1062805943 10:419536-419558 CTGCGTCGACTGTGGCAGACAGG - Intronic
1062958596 10:1556712-1556734 CTCTGTTGACATGGGCAGGCAGG - Intronic
1064034127 10:11901629-11901651 CTGTGTTGCCTAATGAAGGCAGG + Intergenic
1066178642 10:32938293-32938315 CTGTGATGAATGAAGCATGCAGG + Intronic
1066188978 10:33037849-33037871 GTGTGCTGGCTGAGGCAGGCTGG - Intergenic
1066391607 10:34981308-34981330 CGCTGTTGTCTGAGGCATGCAGG - Intergenic
1066758147 10:38730664-38730686 CCGTGGAAACTGAGGCAGGCAGG - Intergenic
1066963540 10:42242043-42242065 CCGTGGAAACTGAGGCAGGCAGG + Intergenic
1067824228 10:49558323-49558345 CTGTGTGGAGTGAGGTAAGCTGG + Intergenic
1069614910 10:69801055-69801077 CTGGGATGATTGAGGCAGGCTGG + Intergenic
1069753442 10:70759702-70759724 GTGTGCTGACTGTGGCAGGATGG + Intronic
1071321394 10:84462943-84462965 CTGGGTTTACTGAGGCAGCCAGG + Intronic
1072117700 10:92379730-92379752 TTATGTTGACTAAGGCAGACCGG - Intergenic
1072200161 10:93150859-93150881 CAGTGGGGAATGAGGCAGGCAGG + Intergenic
1074220884 10:111436602-111436624 CCATGTTGACTGAGGCATGATGG + Intergenic
1074506809 10:114078108-114078130 TTGTGGTGACTGGGGCTGGCAGG - Intergenic
1075088956 10:119432183-119432205 CTGTGTTGACTGGTTCTGGCTGG - Intronic
1076342260 10:129757492-129757514 CTGTGTTCGCCGAGGAAGGCAGG + Intronic
1076566189 10:131400973-131400995 CATTGGTGAATGAGGCAGGCGGG + Intergenic
1076734819 10:132453905-132453927 CTAAGCTGAGTGAGGCAGGCAGG + Intergenic
1077078773 11:713356-713378 CTGTGGTGATGAAGGCAGGCAGG - Intronic
1077852424 11:6085774-6085796 CTGTGTTGCCTGTGGCCTGCAGG - Intergenic
1083006922 11:59355505-59355527 CTGTCTTGACTCAGGCAGGGTGG + Intergenic
1083861626 11:65423124-65423146 CTGTGTGGAAGGAGGAAGGCAGG + Intergenic
1083929129 11:65829783-65829805 CTGTGGCGACTGAAGCAAGCAGG - Intronic
1084322298 11:68380347-68380369 CTGTGTTGACTGAGGCAGGCTGG + Intronic
1084323004 11:68384059-68384081 CTGGGGAAACTGAGGCAGGCAGG - Intronic
1084328284 11:68414457-68414479 CGGGGTTGACTGTGGCAGGCTGG + Intronic
1084542533 11:69796594-69796616 CTGGGATGACGGAGGCAGGCAGG - Intergenic
1085571442 11:77561317-77561339 CTCTTTTGACTGGGACAGGCTGG - Intronic
1088733309 11:112703294-112703316 ATGTGTTGAGGGAGGCAGGTTGG + Intergenic
1089048689 11:115526892-115526914 ATATGTTAACTGAGGGAGGCTGG - Intergenic
1089616959 11:119700165-119700187 TTGTGGTCACTGAGGCAGGGAGG + Intronic
1090025959 11:123168050-123168072 CTTTGTTGACCATGGCAGGCTGG - Intronic
1090430075 11:126638577-126638599 CTGTTTTGCCTTAGGCGGGCTGG + Intronic
1090527711 11:127555517-127555539 TTGTGTTGACAGATGCAGGCAGG - Intergenic
1090917525 11:131178720-131178742 CTGTGTTTACTGAGCCAGCTGGG + Intergenic
1092521687 12:9281774-9281796 CAGTATTGACTAAAGCAGGCTGG - Intergenic
1092927319 12:13283078-13283100 CTGTGAAGACTGAGGCAGCAGGG + Intergenic
1093142323 12:15523665-15523687 CTTGGTAGACTGAGGCAGGAGGG + Intronic
1093487651 12:19669140-19669162 CCATGATGACTGAGGCAGACAGG - Intronic
1094687536 12:32732986-32733008 CTGGGGAGGCTGAGGCAGGCAGG + Intronic
1096879985 12:54659552-54659574 CTGGCTTGATTGCGGCAGGCTGG + Intergenic
1097261945 12:57725390-57725412 CTGGGTTGGCTGAGGGAGGCAGG + Intronic
1098152486 12:67561436-67561458 CTGAGCTGACTAAGACAGGCAGG - Intergenic
1098338987 12:69432290-69432312 CCGTGTTGACTAAAGCAGGTTGG - Intergenic
1101492494 12:105222448-105222470 GTGTGGTGAGTGAGGAAGGCGGG + Intronic
1102005284 12:109585815-109585837 CTGTTTTGACTGCGCCAGGTGGG + Intronic
1103610908 12:122123805-122123827 CTGGGGAGACTGAGGCAGGAAGG - Intronic
1104365648 12:128174138-128174160 CTGTCTTGATTGATCCAGGCTGG + Intergenic
1104598981 12:130139636-130139658 CTGGGTTAAGTGAGGCAGGAGGG - Intergenic
1104753829 12:131256552-131256574 CTGGGTTCACTGAGGCAGGCGGG - Intergenic
1105659150 13:22473900-22473922 CTGTGTTGACTGATGGGGGGTGG - Intergenic
1105870947 13:24505865-24505887 CTGTGTTAGCTTGGGCAGGCAGG + Intronic
1106669300 13:31887983-31888005 CTATGCTGACAGAGGCAGGCAGG - Intergenic
1108333233 13:49411821-49411843 CTGTGTTCCATGAGCCAGGCTGG - Intronic
1112177219 13:97038001-97038023 CTCTGGAGGCTGAGGCAGGCAGG - Intergenic
1113787232 13:113008890-113008912 CTGGGTTCTCTGATGCAGGCGGG - Intronic
1114265190 14:21069631-21069653 CTGTGTTGCCTGGGGAAGGCGGG - Intronic
1114454104 14:22844448-22844470 CAGTGTTGATGGACGCAGGCAGG - Exonic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1115846934 14:37547015-37547037 CAGTGTTGAATGAAGCAGCCTGG - Exonic
1116287531 14:42991719-42991741 CTATCTTGGCTGAGGCAGGAAGG - Intergenic
1117299849 14:54414045-54414067 GTGTGATGACAGAGGCAGACTGG - Intronic
1117407021 14:55413781-55413803 ATGTGCTTACTGAGCCAGGCTGG - Exonic
1117966457 14:61211415-61211437 CTGTGTTCATTTAGCCAGGCTGG - Intronic
1119646292 14:76350888-76350910 CAGTGCTGAGTGAGGCTGGCAGG + Intronic
1121082709 14:91121167-91121189 CTGTGTTGACAGTGTCAGGCAGG - Intronic
1121741758 14:96257692-96257714 CTATGGTGACAGAGGCTGGCAGG - Intronic
1121775035 14:96584754-96584776 CTGTGAGGACTGAGGGAGGGTGG + Intergenic
1122122288 14:99561009-99561031 CTGTGGAGACTGAGGGAGGCAGG - Intronic
1122208135 14:100158670-100158692 CGGTGCTGACTTAGGCAGGGCGG + Intronic
1123980494 15:25597547-25597569 CTGTGGTGACTGAGGAAGTGAGG - Intergenic
1125062029 15:35436718-35436740 CTGTCTTAACTGAGACAGGATGG - Intronic
1125518862 15:40337447-40337469 CTGTGTAGACAGAGGGAGTCAGG + Intronic
1125600642 15:40913781-40913803 CTGTGTAGATAGAGGAAGGCAGG + Intergenic
1126825743 15:52546179-52546201 AGGTGCTGACTGTGGCAGGCAGG + Intergenic
1127841840 15:62838528-62838550 GTGTGTTAACAGAGGCATGCCGG - Intronic
1128304068 15:66586643-66586665 CAGCGTGGACTCAGGCAGGCTGG + Intronic
1128520956 15:68374604-68374626 CTGTGTCTGTTGAGGCAGGCAGG + Intronic
1129326771 15:74803919-74803941 ATGTATTCCCTGAGGCAGGCAGG + Intergenic
1130355805 15:83129427-83129449 CTGTTTATTCTGAGGCAGGCAGG - Exonic
1130835356 15:87644803-87644825 CTGTGTTAAGGGATGCAGGCAGG - Intergenic
1131440622 15:92456866-92456888 GAGTGTTGGCTTAGGCAGGCAGG + Intronic
1132057876 15:98665789-98665811 GTGTGTTGCCTGATGCAGGATGG + Intronic
1132301469 15:100778918-100778940 CTGGGTTGACTCAGGCCGACCGG - Intergenic
1134448686 16:14349822-14349844 CTGGGGTGGCTGAGGCAGGAGGG - Intergenic
1134761790 16:16720936-16720958 CTGTGCTCACCAAGGCAGGCCGG - Intergenic
1134984268 16:18638234-18638256 CTGTGCTCACCAAGGCAGGCCGG + Intergenic
1136724684 16:32348522-32348544 CCGTGGAAACTGAGGCAGGCAGG + Intergenic
1136843011 16:33554562-33554584 CCGTGGAAACTGAGGCAGGCAGG + Intergenic
1138211307 16:55165391-55165413 AGGTTTTGACTGAGGCAGCCTGG - Intergenic
1138907413 16:61353949-61353971 CTGTGTTAAGTGAGGCAGGAAGG - Intergenic
1139613140 16:68073109-68073131 CTGTGGTGGCTGAAGCAGGAAGG + Intronic
1139648933 16:68352056-68352078 GTTTGTTGACTGAGGGAGGGAGG + Intronic
1139661755 16:68425599-68425621 CTGTGATGACAGGGGCAGGGAGG + Intronic
1140203607 16:72914746-72914768 CTTTGGGGGCTGAGGCAGGCAGG + Intronic
1140393311 16:74606882-74606904 CTGCGATGACTGAGGCAGCTGGG + Exonic
1141004784 16:80341824-80341846 CTGTCTTTCCTGAGTCAGGCAGG - Intergenic
1141225872 16:82114412-82114434 GGTTGTTGACTGAGGCAGGTTGG + Intergenic
1141557109 16:84843483-84843505 CTGGCTGGACGGAGGCAGGCTGG - Intronic
1141831531 16:86512098-86512120 TTGTGGTGACTGAGGCAGGAGGG + Intronic
1142225072 16:88873246-88873268 CTGTCTTGACAGTGGCTGGCGGG + Intergenic
1142270477 16:89086538-89086560 CTGTGTCAGCTGTGGCAGGCTGG - Intergenic
1142281714 16:89152141-89152163 CTGTGTTGAATGAGACTGGGTGG - Intronic
1203001746 16_KI270728v1_random:169233-169255 CCGTGGAAACTGAGGCAGGCAGG - Intergenic
1203133349 16_KI270728v1_random:1705639-1705661 CCGTGGAAACTGAGGCAGGCAGG - Intergenic
1203153176 16_KI270728v1_random:1854860-1854882 CCGTGGAAACTGAGGCAGGCAGG + Intergenic
1143054887 17:4155373-4155395 CTTGGGAGACTGAGGCAGGCAGG + Intronic
1144835412 17:18154207-18154229 CTGAGTTCACTGAGGCAGAAAGG - Intronic
1147725794 17:42565498-42565520 CTGTGTTGCTTGAAGCCGGCTGG + Exonic
1148733216 17:49850480-49850502 GTGTGGAAACTGAGGCAGGCCGG + Intergenic
1148773962 17:50083478-50083500 CTTTGGAGACTGAGGCAGGCAGG + Intronic
1148922396 17:51050472-51050494 CTCAGATGACTGAGTCAGGCAGG - Intronic
1150206990 17:63416643-63416665 CTGTGTTCTCTGAGACAGTCAGG - Intronic
1150286468 17:63957144-63957166 TTGTGGTGAGTGAGGCTGGCTGG - Exonic
1150729170 17:67677025-67677047 TTGTGTTTTGTGAGGCAGGCAGG + Intronic
1150924381 17:69517276-69517298 CTGTGTTGCCTGGGACAAGCAGG + Intronic
1152257520 17:79248778-79248800 CTTTGGGGACTGAGGCTGGCAGG + Intronic
1152458415 17:80428947-80428969 CTAAGTGGACTGAGGAAGGCTGG - Intronic
1153056253 18:949556-949578 CTGTGATGATAGTGGCAGGCTGG + Intergenic
1153654120 18:7266921-7266943 CTGTGTTCTCTGATGAAGGCAGG - Intergenic
1156629848 18:38953808-38953830 CTGTGTTGATTGTGTCAAGCAGG + Intergenic
1159042780 18:63340899-63340921 CTGTGTTGTGGGAGGCAAGCAGG - Intronic
1159988164 18:74870099-74870121 CTTAGTAGACTGAGGCAGCCTGG + Intronic
1161493766 19:4576529-4576551 CTGTGTTCACTGAGGCTGTCGGG - Intergenic
1162068452 19:8139659-8139681 CCGGGGTGACTGAGGCAGACAGG + Intronic
1162174870 19:8823360-8823382 AGGGGTTGACTGAGGCAGGAGGG - Intronic
1162380941 19:10331443-10331465 CTTTGGAGGCTGAGGCAGGCGGG + Intronic
1162965965 19:14156241-14156263 CAGTGCTCACTGAGGGAGGCAGG - Intronic
1162997150 19:14343414-14343436 CTGTGTTCACAGAGCCAGCCAGG + Intergenic
1165244024 19:34487647-34487669 CTTTGTTGACTGAGGAAAGGCGG + Intronic
1165246890 19:34503073-34503095 CTGTGATGACTCAGGCCAGCTGG - Exonic
1165333683 19:35154975-35154997 CTGGGGAGACTGAGGCAGGCGGG - Exonic
1165423186 19:35732375-35732397 CTGTGACGACTGAGGTAGGAGGG - Exonic
1166086255 19:40477415-40477437 TAGTGGTGACTGAGGCAGCCTGG + Intronic
1166264847 19:41673535-41673557 CTGTGCTGACTCAGACAGCCTGG + Exonic
1166751747 19:45167139-45167161 CTGTGTTGGCTGCTGAAGGCCGG - Intronic
1167260032 19:48453105-48453127 GTCTGTTGACTGAGACTGGCCGG + Exonic
1168428055 19:56255457-56255479 CTGTGAGCACTGAGGCAGGTTGG - Intronic
926795528 2:16616094-16616116 GTGTGCAGCCTGAGGCAGGCTGG - Intronic
927472683 2:23386830-23386852 CTGCGTTGCCTGGGGAAGGCGGG + Intronic
929666190 2:43835910-43835932 CTGAGTGGACTGAGACAGTCTGG + Intronic
929786932 2:45000213-45000235 CTGGGGAGACTGAGGCAGGGAGG + Intergenic
930017637 2:46981911-46981933 CTGTGATGACTGCAACAGGCAGG + Intronic
931427579 2:62185198-62185220 CTGTGTGGACTGAGTCTGGGTGG - Intergenic
931443409 2:62307206-62307228 CTGTGTTCTCTGTGCCAGGCTGG + Intergenic
932183814 2:69674033-69674055 CAGTGTTCACCGAGGCACGCAGG - Intronic
933277821 2:80302438-80302460 CTGAGCTGCCTGAGGCTGGCTGG + Exonic
934952700 2:98589188-98589210 CTGAGTTCACTGTGGCAGGCAGG + Exonic
937220957 2:120343233-120343255 CTGTGGTGACGGAGACAGCCGGG + Intergenic
938392732 2:130917636-130917658 CTGTGTTCACTGGGGGAGGGGGG - Intronic
940235975 2:151511195-151511217 TTGTGTTCACTGAGGGAGCCAGG - Intronic
941667668 2:168258657-168258679 CACTGTTGCCTTAGGCAGGCAGG - Intergenic
942308638 2:174633418-174633440 TTGTGTTAACTGAGACAGGGAGG - Intronic
942453386 2:176122324-176122346 CGGTGTCGCCCGAGGCAGGCGGG - Intergenic
943652440 2:190471635-190471657 TGGAGTTTACTGAGGCAGGCAGG - Intronic
946311010 2:218882628-218882650 CTGTGTAGGCTGAGGGTGGCAGG + Intronic
947289391 2:228555268-228555290 CTGTGTTGGCTGTGGCTGACAGG + Intergenic
947573114 2:231250758-231250780 CTGTGTTGAGTGTGGAAGGAGGG + Intronic
947699061 2:232217330-232217352 CTGTGTTGATTGTTGCAGGGTGG - Intronic
948648488 2:239424322-239424344 CTGTGCAGACTGAGACAGGCTGG + Intergenic
1168850775 20:975433-975455 GTGTTTTGACTGAGGGAGGATGG - Intronic
1169133356 20:3179826-3179848 CTCAGGAGACTGAGGCAGGCAGG - Intergenic
1170010683 20:11719309-11719331 CAGTGTAGAATCAGGCAGGCTGG - Intergenic
1171488647 20:25501280-25501302 GTGTGCTGACTGGGGCTGGCCGG - Intronic
1172506080 20:35463693-35463715 ATTTGTTGACTGAGGGAGGTTGG + Intronic
1173290724 20:41712685-41712707 CTGTGTTTAGGGAAGCAGGCTGG - Intergenic
1173648116 20:44646211-44646233 CTGTGTTCACACAGGGAGGCAGG - Intronic
1175304609 20:57967220-57967242 CCCTGTTGTGTGAGGCAGGCTGG - Intergenic
1175395559 20:58657472-58657494 CTGTGTTTACTCAGGAAGTCTGG - Intronic
1176255778 20:64152176-64152198 CTGTGTTGGCTGCTGCAGGTCGG + Intronic
1179567691 21:42259506-42259528 GTGCATTGACTGAGGCTGGCTGG + Intronic
1180063978 21:45403985-45404007 CTGGGAAGGCTGAGGCAGGCAGG + Intergenic
1180309717 22:11159073-11159095 CCGTGGAAACTGAGGCAGGCAGG - Intergenic
1180548194 22:16520883-16520905 CCGTGGAAACTGAGGCAGGCAGG - Intergenic
1181006026 22:20013978-20014000 CTGGGGAGACTGAGGCAGGAGGG - Intronic
1181086482 22:20441893-20441915 CTGAGATGCCTGCGGCAGGCTGG + Exonic
1181098815 22:20524978-20525000 CTGTGTTGACTGAGACAGGAAGG + Intronic
1181486899 22:23237285-23237307 CTGTGCTCATGGAGGCAGGCTGG + Intronic
1181821283 22:25477635-25477657 GTGGGTTGGCTGAGCCAGGCTGG + Intergenic
1182624185 22:31634050-31634072 GTGGCTTGACTGAGGCAGGGAGG - Intronic
1183457109 22:37928878-37928900 CTTTGGAGGCTGAGGCAGGCAGG + Intronic
1183467412 22:37986675-37986697 CAGTGTTGGGTGAGGCAGGTGGG + Intronic
1183759004 22:39798921-39798943 CTGTGGTGATAGTGGCAGGCTGG + Intronic
1184200481 22:42965331-42965353 CTGTCTTGACTGAGTCATACAGG + Intronic
1184813252 22:46851762-46851784 CTTTGTTGACTGTGGTTGGCAGG + Intronic
1184996712 22:48212422-48212444 TTGTGCTTTCTGAGGCAGGCAGG + Intergenic
949834283 3:8251130-8251152 CTGTGCTGATAGAGACAGGCAGG - Intergenic
952810769 3:37400594-37400616 CTGTTTTGGCTGAGGCTGGCTGG + Intronic
952879200 3:37972698-37972720 CTGTGCTGTGTGGGGCAGGCAGG + Intronic
953407174 3:42665230-42665252 CTGTGTGGAGTGGGGCAGGCAGG + Exonic
954334120 3:49906254-49906276 ATGTGTTGACTGTGGAATGCAGG - Intronic
954415409 3:50391036-50391058 CTGGCTTGGCAGAGGCAGGCAGG + Intronic
957709011 3:83829255-83829277 CTGTGTGGTCTGTGGCAGGGGGG - Intergenic
959859506 3:111200876-111200898 CTGTGTAAACTGAGGTAGTCCGG + Intronic
960996767 3:123345311-123345333 CTGTGTTGGCCGAGGCAGGCTGG + Intronic
961006631 3:123410033-123410055 CTGTGTTCCCTGAGGCAGTGTGG + Intronic
961424820 3:126836776-126836798 CTGTTCTGCCTGAGCCAGGCTGG + Intronic
965417915 3:168420375-168420397 CTGAGTTGACTAAGACAGGGAGG + Intergenic
965728172 3:171742331-171742353 CTCTGGAGGCTGAGGCAGGCAGG - Intronic
968494911 4:910228-910250 CTGTGCTGAGTGAGGGAGGGTGG - Intronic
968538263 4:1148783-1148805 CTGTGGAGACTGAGGCAGGAGGG - Intergenic
968819272 4:2837503-2837525 CTTAGTTCCCTGAGGCAGGCAGG + Exonic
968940574 4:3635405-3635427 CTGTGTTGACTGAGGATGGGAGG - Intergenic
971018496 4:22512006-22512028 CTAGGGAGACTGAGGCAGGCAGG - Intronic
972130243 4:35824005-35824027 CTGTGTTGCCAGAGGCAGTCGGG - Intergenic
975387960 4:73780746-73780768 CTGTGTTGATAGAGGTAGGAAGG + Intergenic
978634292 4:110785482-110785504 CAGTGTTCCCTGTGGCAGGCTGG + Intergenic
979347694 4:119607627-119607649 CTGGGGAGACTGAGGCAGGAGGG + Intronic
979723104 4:123926296-123926318 CTGTGGTGACTGAGCAAGGCGGG - Intergenic
981239466 4:142459011-142459033 ATGAGTTGTCTGAGTCAGGCTGG - Intronic
985829216 5:2215618-2215640 CTGTGTTGGCAGAGGTGGGCAGG + Intergenic
987703802 5:21437166-21437188 CTGGGTTTATTCAGGCAGGCAGG - Intergenic
990131693 5:52594466-52594488 CTGTGTTGACTGAGGTCAGTTGG - Intergenic
990673288 5:58156612-58156634 CTGAGTTGACTCAGCCACGCTGG + Intergenic
990682257 5:58258189-58258211 CTGCATTTACTGAGGCAGGGTGG + Intergenic
991106601 5:62851208-62851230 CTGTGATGACAGTGGCAGGGTGG + Intergenic
991584981 5:68192811-68192833 GTGTGATGTCTGAGGCTGGCTGG - Intronic
991969574 5:72126116-72126138 CTGTGTTGAGGGAAGCAGGGAGG + Intronic
992001246 5:72438477-72438499 ATCTGGTGACTGAGCCAGGCAGG + Intergenic
994992065 5:107009500-107009522 TTTAGTTGATTGAGGCAGGCAGG + Intergenic
995253427 5:110019237-110019259 CTGTGGTGACTGTGGCATACTGG - Intergenic
996519939 5:124415152-124415174 CAGTGTTGACTGGGTGAGGCCGG + Intergenic
999187725 5:149725159-149725181 TTGTGTTGAATGAGGGAGGGAGG - Intergenic
999511785 5:152259838-152259860 CTGTGTGTATTGAGCCAGGCTGG + Intergenic
1001319795 5:170671043-170671065 CTGTGTCTTCTGAGGCAGTCTGG + Intronic
1001780965 5:174368795-174368817 GTGTGGTGACTGAGCAAGGCAGG + Intergenic
1002495341 5:179607768-179607790 CTGTGCTGACTGTGGCAGATGGG + Intronic
1004493178 6:16137309-16137331 CTCATTGGACTGAGGCAGGCTGG + Intronic
1005632675 6:27723232-27723254 CTGGGGAGACTGAGGCAGGAGGG + Intergenic
1005948427 6:30612834-30612856 CTGAGTTGATGAAGGCAGGCAGG + Intronic
1006341457 6:33449283-33449305 CTGTGCTGACTGCAGCAGGTAGG + Intronic
1006403517 6:33831280-33831302 CTGTGGAGAGTGACGCAGGCAGG - Intergenic
1007315908 6:40988801-40988823 TTGTGTTGACAGAGCCAGGTTGG - Intergenic
1007737038 6:43988141-43988163 CTGTTTTGGCTGAGGCAGGCTGG + Intergenic
1015759623 6:136644563-136644585 CTGTATTGACTGAAGGTGGCAGG + Intronic
1016614340 6:146029030-146029052 CTGTGGTCACTGAGGAAGGCGGG - Intronic
1016874005 6:148846958-148846980 CTCTCCTGAGTGAGGCAGGCTGG + Intronic
1018444358 6:163841690-163841712 GTGTGATGACTCTGGCAGGCTGG + Intergenic
1018950980 6:168378728-168378750 CTGTGTTGACTCAGGCTGTGTGG - Intergenic
1018951287 6:168380287-168380309 CTGTGTTGACTCAGGCTGTGTGG - Intergenic
1021814619 7:24435241-24435263 CGGTGGTGAGTGAGGCAGGAAGG - Intergenic
1022632402 7:32097706-32097728 CAGTGTTGGCTGAGGCTAGCTGG - Intronic
1023504885 7:40889071-40889093 CTGTGATGAATGGGGCAGGAGGG + Intergenic
1023579007 7:41661648-41661670 CTGTGAAGACTAAGGCAGACTGG + Intergenic
1024706919 7:51971190-51971212 CAATGTTGTCTGAGGCAGCCTGG - Intergenic
1025716926 7:63966640-63966662 CTGTGTGAAATGACGCAGGCTGG + Intergenic
1027176468 7:75906962-75906984 CTTTGGAGGCTGAGGCAGGCAGG + Intronic
1028789299 7:94835188-94835210 CTGAGGAGGCTGAGGCAGGCAGG - Intergenic
1029416057 7:100443880-100443902 CTTTGTTGGCTGAGGCAGGAGGG + Intergenic
1029431333 7:100532910-100532932 CTCTATTGACTGAGGAAGACTGG - Intergenic
1030673910 7:112365241-112365263 CAGTGTTGGCTGAGGCTTGCAGG + Intergenic
1031288405 7:119901184-119901206 CTGTGTTGCCTGGGGCTGGGTGG + Intergenic
1032304225 7:130717489-130717511 CTGGAGTGACTGAGACAGGCTGG - Intergenic
1032785831 7:135198465-135198487 AAGTGATGACTAAGGCAGGCCGG + Intronic
1035060765 7:156067524-156067546 CTGTGATGACTGACGCTGGGAGG + Intergenic
1035690967 8:1559377-1559399 ATTTGTTTGCTGAGGCAGGCTGG + Intronic
1035826448 8:2649185-2649207 AGGTGTGCACTGAGGCAGGCTGG - Intergenic
1037910536 8:22741288-22741310 CTGGGTTGACGAAGGCAGGCAGG - Intronic
1039305363 8:36256171-36256193 CTTGGGAGACTGAGGCAGGCAGG - Intergenic
1039571815 8:38592953-38592975 CTGTCTTTACTGTGTCAGGCAGG - Intergenic
1040979500 8:53231650-53231672 CAGTGTTGATTAAGGCAGGCTGG - Intronic
1041570562 8:59333164-59333186 CTGTCTTGGCTGAGTCATGCAGG + Intergenic
1042935024 8:74049908-74049930 CTCTGCTGGCTGAGGCAGGAGGG + Intergenic
1044462182 8:92458415-92458437 ATGTGTTGAGTGATGGAGGCTGG - Intergenic
1046000874 8:108419820-108419842 CTCGGGAGACTGAGGCAGGCAGG + Intronic
1046353506 8:113047093-113047115 CTGAGTGGTCTGAGGGAGGCTGG + Intronic
1048351236 8:133618380-133618402 CTGTGTTGACTTAGGGAATCAGG + Intergenic
1049000485 8:139822804-139822826 CTGAACTGACTGTGGCAGGCAGG - Intronic
1049231875 8:141488795-141488817 CTGTGTGGCCTCAGGCGGGCTGG + Intergenic
1049713647 8:144078992-144079014 CTGTGTAGACTGAGGCGCGCCGG - Intronic
1049744689 8:144258305-144258327 CAGTGTCGGCTGAGGCTGGCTGG - Intronic
1051098981 9:13499340-13499362 CTGACTTTACTGAGCCAGGCAGG + Intergenic
1054948241 9:70820152-70820174 CTCTGTTTACTGAGGCAGGAGGG + Intronic
1056533484 9:87507878-87507900 ATGTGATGAATGAGGCTGGCTGG + Intronic
1056710044 9:88984963-88984985 CTGTTTTGACTGAGGCTTACTGG - Intergenic
1057034935 9:91805135-91805157 CAGTGGTCACTGAGGCAGACAGG - Intronic
1057236688 9:93366838-93366860 CTGTGTGGGCTGGGGCAGGAGGG - Intergenic
1057261725 9:93588213-93588235 CTGTGTGGCCCTAGGCAGGCAGG + Intronic
1058200190 9:102028829-102028851 CTGTGTTGCCAGTGGCTGGCCGG + Intergenic
1059217203 9:112575148-112575170 CTGTGTTAACTGAGGGAGAAAGG - Exonic
1059820722 9:117969343-117969365 CTCTATTGAATTAGGCAGGCAGG + Intergenic
1061309924 9:129755455-129755477 CTGTGTGGCCTTAGGCAGGCAGG + Intergenic
1061598058 9:131645531-131645553 CTGAGTTCACGGAGGCAGCCTGG - Intronic
1061828885 9:133277915-133277937 CTCTGCTGTCTGAGGCAGGATGG + Intergenic
1061921902 9:133787199-133787221 CTGGGATGATTGAGGCAGGTGGG + Intronic
1062080771 9:134622313-134622335 CTGTGCTGAATGAGGCTGGAAGG - Intergenic
1062482645 9:136759544-136759566 CTGGGGAGACTGAGGCAGGGAGG - Intergenic
1062627239 9:137448841-137448863 CAGTGTAGACAGAGCCAGGCTGG + Exonic
1062725830 9:138073002-138073024 CTTTGCTGACTGAGCCAGGGAGG + Intronic
1186150802 X:6672686-6672708 CTAGCTTGACTGAGGCAGGAGGG + Intergenic
1187326524 X:18295405-18295427 CTGAGATGACAGCGGCAGGCTGG - Intronic
1187579599 X:20593742-20593764 CTGTGTTCCATGGGGCAGGCCGG + Intergenic
1188043967 X:25404199-25404221 CTGAGTCTACAGAGGCAGGCAGG + Intergenic
1188370259 X:29361151-29361173 TGGTGTTGACTGATGCAGGGAGG + Intronic
1188751901 X:33914423-33914445 CAGTGATGATTGTGGCAGGCCGG + Intergenic
1189398537 X:40645070-40645092 CTGAGGTGACAAAGGCAGGCAGG + Intronic
1194382961 X:93218177-93218199 CTGCTTTGACTGAAGCAGGAGGG - Intergenic
1195671336 X:107472694-107472716 CTGTTTTGCCTGGGGCTGGCTGG - Intergenic
1197565804 X:128084611-128084633 CTCTTTTCACTGTGGCAGGCTGG - Intergenic
1198112785 X:133516318-133516340 CTGTACTCACTGAGGCAGACAGG + Intergenic
1201188947 Y:11430229-11430251 CCGTGGAAACTGAGGCAGGCAGG - Intergenic
1201935948 Y:19411238-19411260 CATTGTTGACTGTGGCTGGCTGG - Intergenic