ID: 1084323522

View in Genome Browser
Species Human (GRCh38)
Location 11:68386388-68386410
Sequence GTCCACCTGCAGCACGATGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084323522_1084323527 20 Left 1084323522 11:68386388-68386410 CCGACATCGTGCTGCAGGTGGAC 0: 1
1: 1
2: 0
3: 10
4: 110
Right 1084323527 11:68386431-68386453 CATCGACTACGACCCGCTAGAGG 0: 1
1: 0
2: 0
3: 0
4: 7
1084323522_1084323528 21 Left 1084323522 11:68386388-68386410 CCGACATCGTGCTGCAGGTGGAC 0: 1
1: 1
2: 0
3: 10
4: 110
Right 1084323528 11:68386432-68386454 ATCGACTACGACCCGCTAGAGGG 0: 1
1: 0
2: 0
3: 0
4: 6

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084323522 Original CRISPR GTCCACCTGCAGCACGATGT CGG (reversed) Exonic
907269990 1:53285396-53285418 GGCCCCCAGCAGCATGATGTAGG + Intronic
912400711 1:109389447-109389469 TTCCAAATGCAGCACCATGTTGG + Intronic
912673032 1:111649115-111649137 GTCAATCTGCAGAACGATGTGGG + Intronic
918993957 1:191732182-191732204 CTCCACCTGCGGCCCGGTGTGGG + Intergenic
1064653398 10:17532570-17532592 GTCTACCTTCAGCACCATTTTGG - Intergenic
1065322434 10:24521939-24521961 GGCCACCCCCAGCACGATGAGGG - Intronic
1068863243 10:61868055-61868077 CTCCACCTGCAGCCCGGTGCAGG + Intergenic
1069090735 10:64196721-64196743 CTCCACCTGCGGCCCGGTGTGGG - Intergenic
1071843068 10:89493051-89493073 GGCCACCTGCAGCTCACTGTTGG - Intronic
1075464852 10:122643497-122643519 GACCAGGTGCAGCACAATGTAGG - Exonic
1076447657 10:130528687-130528709 CTCCACCTCCAGCCCGACGTGGG - Intergenic
1077104754 11:837337-837359 GACCAGCTGCAGCAGGAGGTGGG + Exonic
1077994811 11:7444052-7444074 GTCTACCTGCAGGTCGATGAGGG + Intronic
1080827580 11:35861071-35861093 GTCGATCTGCAGAATGATGTGGG + Intergenic
1082734988 11:56845602-56845624 CTCCACCTGCAGCCCCCTGTGGG + Intergenic
1084323522 11:68386388-68386410 GTCCACCTGCAGCACGATGTCGG - Exonic
1084463001 11:69306674-69306696 GTGCACCTGCCCCACGATGGGGG + Intronic
1088598292 11:111455795-111455817 GCCCTCCTGCAGCACGACCTGGG - Exonic
1088692458 11:112339264-112339286 GTCCTCCTGCTGCATGATTTAGG + Intergenic
1089454418 11:118617711-118617733 GTCCACCAGCAGCAGTACGTAGG + Intronic
1089540459 11:119186544-119186566 TTCCACCTGCAGCAGGAGCTGGG + Exonic
1090133488 11:124170670-124170692 CTCCACCTGCAGCCCGGTGCGGG - Intergenic
1096634638 12:52950353-52950375 GTCAATCTGCAGAACGATGCGGG - Exonic
1101468998 12:104977564-104977586 GTCGATCTGCAGAACGATGCAGG + Intergenic
1110258620 13:73459690-73459712 GTGCACCTACAACACAATGTTGG - Intergenic
1111581673 13:90230833-90230855 GTCTATCTGCAGAACGATGTGGG - Intergenic
1113732149 13:112649234-112649256 GGCCTCTTGCAGCAAGATGTAGG - Intronic
1114674407 14:24430879-24430901 CTCCAGCTGCAGCCAGATGTGGG - Exonic
1115662694 14:35512622-35512644 GTCAATCTGCAGAACGATGCAGG + Intergenic
1118966841 14:70595001-70595023 GTCGATCTGCAGAACAATGTGGG - Intronic
1119404898 14:74392110-74392132 GTCCACCTGCCCAAAGATGTAGG - Intergenic
1121637892 14:95466123-95466145 GCCCAGCTGGAGCTCGATGTGGG + Exonic
1124971651 15:34495201-34495223 GGCCGCCTGCAGCACGACCTGGG - Intergenic
1132895985 16:2229613-2229635 GGCCGCCTCCACCACGATGTGGG - Exonic
1133320385 16:4909940-4909962 CTCCACCTGCAGGCCGATGCTGG + Intronic
1140181953 16:72729057-72729079 GTCAATCTGCAGAACGATGCAGG - Intergenic
1142518798 17:491175-491197 GTCCACCTGTAGCGCGCTGGGGG - Intergenic
1142593238 17:1016937-1016959 GGCTTCCTGCAGCTCGATGTAGG + Intronic
1142898607 17:2998324-2998346 CTCGACCTGCACGACGATGTAGG - Exonic
1145742701 17:27289204-27289226 TTCCACTTGCAGCATCATGTTGG + Intergenic
1145871439 17:28276879-28276901 GTCGATCTGCAGAACAATGTGGG + Intergenic
1146163052 17:30570216-30570238 GTCAATCTGTAGCAGGATGTTGG + Intergenic
1147486596 17:40821070-40821092 GTCGATCTGAAGCAGGATGTTGG + Exonic
1147580038 17:41622985-41623007 GTCAATCTGTAGCAGGATGTTGG + Exonic
1151882187 17:76902611-76902633 GTCCACCTTCACAGCGATGTCGG - Exonic
1153907873 18:9679072-9679094 GTCAATCTGCAGCACGATGCAGG + Intergenic
1160040132 18:75337580-75337602 CCCCACCTGCAGCCCCATGTTGG - Intergenic
1160356438 18:78231133-78231155 TTCTAACTGCAGCAGGATGTGGG - Intergenic
1162349419 19:10139670-10139692 GCCCACCTGCAGCACGCCGAAGG + Exonic
1163459418 19:17427649-17427671 TTCCAACTGCAGCAGAATGTGGG - Intronic
1163738705 19:18997458-18997480 CTCAACATGCAGCAAGATGTAGG + Intronic
1163986841 19:20961527-20961549 GTCGATCTGCAGAACGATGTGGG - Intergenic
1165031266 19:32999557-32999579 GTCCCCCTGCACCCAGATGTGGG - Intronic
1165403021 19:35613762-35613784 GTGCACATGCTGCAAGATGTAGG - Exonic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
924962073 2:44970-44992 GTCCACCTGCAGCCCTAGGTAGG - Intronic
925279774 2:2675460-2675482 GTCTACTTGCAGAAAGATGTTGG + Intergenic
925734313 2:6948007-6948029 GACCACCTGCAGCCCAATCTAGG + Intronic
931069254 2:58626022-58626044 GTCCACCTGGACCACGAAGCAGG - Intergenic
931791384 2:65666910-65666932 GTCGACTTGCAGAACGATGCGGG - Intergenic
936069847 2:109359677-109359699 TTCCACTTGCAGCATCATGTTGG - Intronic
946926171 2:224629444-224629466 GTTCACCAGGAACACGATGTGGG - Intergenic
948770073 2:240247310-240247332 GTCCACCTCCAGCAGGATCAGGG - Intergenic
1169475547 20:5928207-5928229 GTCCACCTGCAGGACAATGATGG - Intergenic
1170400007 20:15971664-15971686 GTCCACCTATGGCACCATGTGGG + Intronic
1171140096 20:22733625-22733647 GTCAATCTGCAGAACGATGTGGG + Intergenic
1171360639 20:24584216-24584238 TTCCACCTGGAGCACGAGGGTGG - Intronic
1177387393 21:20425776-20425798 GTCGATCTGCAGAACGATGCAGG + Intergenic
1179087940 21:38237059-38237081 GTCCACCAGCAGCAAGAGGAAGG + Intronic
1180130068 21:45821477-45821499 TTCCCCCTGCACCACGCTGTGGG + Intronic
1181803147 22:25360129-25360151 GTCCAGCTGCAGCACGATGTCGG + Exonic
1183080755 22:35454528-35454550 GTCCACCTTCTGCAGGCTGTGGG - Intergenic
1184970721 22:48018034-48018056 GTCAACCTGCAGCCTGATGTGGG + Intergenic
951170543 3:19536915-19536937 GTCCAGCTGCAGCTCCATGCAGG - Intergenic
953648270 3:44775292-44775314 GTCCTCCTGCAGAAAGATCTGGG + Exonic
956423833 3:69112449-69112471 GTCAACCTGAAGCAGAATGTGGG + Intronic
960227462 3:115184836-115184858 CTCCACCTGCAGCCCGGTGCGGG - Intergenic
961917130 3:130388598-130388620 GTCCACCAGAAACATGATGTCGG - Exonic
964119062 3:153163166-153163188 GTTCATCTGCCGCACGATCTCGG - Exonic
967871659 3:194234813-194234835 GTCCTCCTGCTCCACGATTTGGG + Intergenic
968397502 4:256531-256553 GTCCAGCTGCTGCACCATCTGGG - Intergenic
982921343 4:161277640-161277662 CTCCACCTGCAGCCCGGTGCGGG + Intergenic
983998166 4:174210989-174211011 TTCTCCCTGCAGCAAGATGTGGG + Intergenic
985531342 5:435487-435509 GAGCACCTGCCGCACGGTGTGGG - Exonic
986946761 5:13030189-13030211 GCCCACCTGCAGCTCAATGGGGG + Intergenic
986993344 5:13578883-13578905 CTCCACCTGCAGCCCGGTGCCGG + Intergenic
990137835 5:52668741-52668763 CCCCACCTGCAGCACCATGCAGG + Intergenic
997375576 5:133394763-133394785 CTCCACCTGCAGCCCGGTGAGGG + Intronic
1002902813 6:1424008-1424030 GTCCACCTGCAGCGGGAGGTGGG + Intergenic
1004883767 6:20032723-20032745 CTCCACCTGCGGCCCGGTGTGGG + Intergenic
1005761228 6:28969958-28969980 GTCAATCTGCAGAACGATGCGGG + Intergenic
1005832888 6:29685058-29685080 GACCATCTGCACCACTATGTAGG + Intergenic
1006044181 6:31280477-31280499 GTCGACTTCCCGCACGATGTGGG - Intronic
1006495119 6:34417245-34417267 TTCCAACTGCAGCACCATATGGG + Intronic
1011242589 6:85288162-85288184 GTCGATCTGTAGAACGATGTGGG - Intergenic
1018758866 6:166872918-166872940 GTCCACCTGGAGCCCGACGCAGG + Intronic
1020137106 7:5593718-5593740 GGCCGCCTGCAGCACGACCTGGG - Exonic
1021070344 7:16230988-16231010 GACCAGCTGCAGCACTAGGTGGG - Intronic
1023891429 7:44394756-44394778 GCCCACCATCAGCACCATGTGGG + Intronic
1023987981 7:45109019-45109041 GTCCACCTGCTTCTCTATGTAGG + Exonic
1024499846 7:50093251-50093273 GCCCACCTGCAGCCGGAAGTTGG + Exonic
1028303229 7:89228715-89228737 CTCCACCTGCACCCCGGTGTGGG - Intronic
1037764534 8:21764207-21764229 ATCCACCAGCACCTCGATGTTGG - Intronic
1039952257 8:42181548-42181570 GACCACCTCCACCACGCTGTTGG + Intronic
1040619316 8:49072010-49072032 CTCCACCTGCAGCACCACGCTGG - Intronic
1048437766 8:134433696-134433718 GTGCACCTGCAGCCCGCTGCTGG + Intergenic
1048987697 8:139743950-139743972 ATCCACCTAAAGCACCATGTTGG + Intronic
1049033682 8:140057954-140057976 GACCACCTGCACCACGCTGGGGG + Intronic
1052611027 9:30773880-30773902 GTCAACCTGCAGAACAATGTGGG - Intergenic
1052998747 9:34565739-34565761 GTCGACAGGCAGCACGAAGTGGG + Intronic
1054323760 9:63702957-63702979 GTCCACCCGCAGGAGGGTGTCGG - Intergenic
1055442899 9:76354118-76354140 GTCCATGTGCAGCACCAGGTTGG - Exonic
1056329351 9:85509053-85509075 GTCCACCTGCAAGGCCATGTAGG - Intergenic
1060660073 9:125400039-125400061 GACCACCTGGAGCACGCTGGAGG - Intergenic
1062342729 9:136100891-136100913 GCCCACCTGCAGGACAATGGGGG + Intergenic
1188939583 X:36220091-36220113 TTCCACCTGTGGCACCATGTTGG - Intergenic
1190901756 X:54681771-54681793 TACCACCTTCAGTACGATGTTGG + Intergenic
1198892650 X:141415627-141415649 GACCACGTTCAGCACTATGTGGG - Intergenic
1200954692 Y:8931285-8931307 CTCTACCTGCAGCTCCATGTTGG + Intergenic
1202232837 Y:22672671-22672693 CTCCACCTGCCGCTCCATGTCGG + Intergenic
1202310319 Y:23523487-23523509 CTCCACCTGCCGCTCCATGTCGG - Intergenic
1202560482 Y:26147106-26147128 CTCCACCTGCCGCTCCATGTCGG + Intergenic