ID: 1084325608

View in Genome Browser
Species Human (GRCh38)
Location 11:68398142-68398164
Sequence AAACACGTGCTGTCAGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084325602_1084325608 3 Left 1084325602 11:68398116-68398138 CCTCAGACAACAGAACTCTCCCC 0: 1
1: 0
2: 1
3: 13
4: 199
Right 1084325608 11:68398142-68398164 AAACACGTGCTGTCAGAGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 90
1084325601_1084325608 4 Left 1084325601 11:68398115-68398137 CCCTCAGACAACAGAACTCTCCC 0: 1
1: 0
2: 1
3: 8
4: 144
Right 1084325608 11:68398142-68398164 AAACACGTGCTGTCAGAGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084325608 Original CRISPR AAACACGTGCTGTCAGAGGG TGG Intronic
910509365 1:87986317-87986339 AAACACCTGCTGTCAGCAGAGGG + Intergenic
922626771 1:227054354-227054376 AAACACATGCTGACAGAAGTTGG + Intronic
1062986158 10:1771241-1771263 AAACACGTGCTGTGAAAAGCAGG - Intergenic
1064216268 10:13403270-13403292 AAACAAGATCTGTCACAGGGGGG - Intergenic
1064297164 10:14089191-14089213 AAACAGGTACAGTCAGAAGGAGG - Intronic
1070487423 10:76943974-76943996 ACAGACGAGCTGCCAGAGGGTGG - Intronic
1071893219 10:90035223-90035245 TAACACGGTCTGTCAGGGGGTGG + Intergenic
1073601413 10:104849480-104849502 AAACACCTGGTGACAGTGGGTGG + Intronic
1076631524 10:131854955-131854977 CAACAAGTGATGTCAGAGAGAGG - Intergenic
1080520164 11:33061595-33061617 AAACACGCCCTGCCAGTGGGGGG + Exonic
1080576997 11:33609205-33609227 AAAAACATGCTGTCAGATGCAGG + Intronic
1084039531 11:66533681-66533703 AAAGAGGAGCTGTCAGATGGTGG - Intronic
1084325608 11:68398142-68398164 AAACACGTGCTGTCAGAGGGTGG + Intronic
1086197968 11:84164784-84164806 AAAAACATGCTGTGAGTGGGTGG - Intronic
1089787510 11:120918553-120918575 AAACACGTGCTCTGGGATGGGGG + Intronic
1092087190 12:5772882-5772904 AAACACGTGCTGTCAAGAAGGGG + Intronic
1092728226 12:11504992-11505014 AAACACTTGCTGACAGAGGCTGG - Intergenic
1102958488 12:117075383-117075405 AATCACTGACTGTCAGAGGGAGG + Intronic
1104106195 12:125661837-125661859 AGACCCGTGCTCTTAGAGGGAGG + Exonic
1107750875 13:43565121-43565143 AAGCAGGTGCTGTCATGGGGTGG + Intronic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1112793000 13:103024249-103024271 CAACACACACTGTCAGAGGGTGG - Intergenic
1113251165 13:108454339-108454361 AAATAAGTGCTACCAGAGGGTGG - Intergenic
1113946275 13:114045527-114045549 ACACAGGTGGGGTCAGAGGGAGG - Intronic
1113985355 13:114310617-114310639 AAACATGTGATGTCACAGTGTGG - Intergenic
1114720542 14:24876464-24876486 AAACATGTGTTGTCAGAGCCTGG - Intronic
1116085301 14:40229613-40229635 AAACAAGAGGTGTGAGAGGGAGG - Intergenic
1121140101 14:91534091-91534113 AAAAACGGCCTGTCAGAGGATGG - Intergenic
1126098161 15:45103884-45103906 AAACAGGTCCAGTCAGAGGAGGG - Intronic
1133416340 16:5610054-5610076 ATACACTGGATGTCAGAGGGTGG - Intergenic
1137892125 16:52173762-52173784 AAACACGTCCAGCCAGAGGGTGG + Intergenic
1140629710 16:76836607-76836629 AAACAAATGCACTCAGAGGGAGG - Intergenic
1144060494 17:11579811-11579833 AGACACGTTCTCTCAGAGCGTGG + Intergenic
1146522555 17:33537396-33537418 AAGCACGTGCTGTGGCAGGGTGG - Intronic
1154324085 18:13377207-13377229 AAAACAGTGCTGTCAGAGGATGG - Intronic
1155213114 18:23619676-23619698 AAAGACGTTCTGTGAGCGGGTGG - Intronic
1158302041 18:56063283-56063305 AAACAGGTGATCTCAGAAGGGGG + Intergenic
1164168374 19:22702434-22702456 AAAAAAGTACTGTCAGAGGAAGG - Intergenic
1166245944 19:41525695-41525717 CACCAGGTCCTGTCAGAGGGTGG + Intergenic
933828214 2:86183502-86183524 AAACACATTCTGTCAAAGGGAGG - Intronic
935914584 2:107935597-107935619 CAAACAGTGCTGTCAGAGGGTGG - Intergenic
937840297 2:126518440-126518462 GAACAGGTGCTGTGAGTGGGTGG + Intergenic
939882626 2:147647500-147647522 AACCACGGGATGTCAGATGGCGG + Intergenic
943700180 2:190980842-190980864 TAATACGTGCTGTAAGAGGGCGG + Intronic
943970787 2:194403797-194403819 CAACACACACTGTCAGAGGGAGG - Intergenic
947309476 2:228784775-228784797 CAACAGGGCCTGTCAGAGGGTGG + Intergenic
1170505823 20:17024855-17024877 AAAAACGTGCTATCTGAAGGAGG + Intergenic
1171156861 20:22882563-22882585 CAACACACACTGTCAGAGGGTGG - Intergenic
1171438264 20:25140599-25140621 AAACATGTGCTGACAGATGCTGG - Intergenic
1175389739 20:58619376-58619398 AAGCACGTGCGGTCAGCGGTGGG + Intergenic
1175855358 20:62118149-62118171 GAAGACGGGCTGTCAGCGGGAGG - Intergenic
1175909660 20:62398701-62398723 AAACACTGGCTTTCAGTGGGAGG - Intronic
1180934661 22:19617331-19617353 AAAAACGTGTTGGCAGGGGGAGG + Intergenic
1183352549 22:37342348-37342370 GAACAGGTGCTGCTAGAGGGAGG - Intergenic
1184711773 22:46254697-46254719 AGACACATGCTGTCTGTGGGTGG - Intergenic
949744151 3:7268978-7269000 AAACACATTCTGTCTGATGGAGG - Intronic
950240314 3:11363974-11363996 AAATACTTCCTGTCAGAGAGTGG - Intronic
955792234 3:62600483-62600505 AAATACTTCCTGTAAGAGGGTGG + Intronic
963051948 3:141150259-141150281 AAACAGATGATGTCAGAGGGCGG + Intergenic
964177576 3:153843037-153843059 TATCAAGTGCTGTCTGAGGGAGG + Intergenic
965969769 3:174540386-174540408 GAACAGGTGCTGTCAGAATGAGG - Intronic
969189269 4:5503753-5503775 AAACATGTGCTGAGAGAGGCAGG - Intergenic
969272398 4:6111690-6111712 AAGCACGGGCTGTCACAGAGGGG - Intronic
974542567 4:63257013-63257035 AAACACTTGCAATCAGAGAGGGG - Intergenic
983556233 4:169061590-169061612 AAACAAAAGCTGTCAGAGTGGGG + Intergenic
984212692 4:176869971-176869993 CAACGGGTCCTGTCAGAGGGTGG - Intergenic
986557245 5:9024199-9024221 CAACACACACTGTCAGAGGGTGG - Intergenic
990443090 5:55866218-55866240 AACAATGTGCTGGCAGAGGGTGG - Intronic
992474392 5:77087992-77088014 CAAAACTTGCTGTCAGTGGGTGG + Intergenic
993571569 5:89546350-89546372 AAACACATGCTGTTAGTGAGTGG + Intergenic
998682903 5:144490011-144490033 ACACAAGTAGTGTCAGAGGGAGG - Intergenic
999030220 5:148282154-148282176 AAACAGGTGCTGTCACATTGGGG - Exonic
1002189278 5:177470378-177470400 AGACAGGTCCTCTCAGAGGGAGG - Intronic
1002985867 6:2190629-2190651 AAACATGTGCTGTGTCAGGGAGG - Intronic
1004955049 6:20720368-20720390 AAACATGTGCTGTACGTGGGTGG - Intronic
1005222207 6:23599438-23599460 AAACACCTGTTAACAGAGGGAGG + Intergenic
1007031416 6:38630941-38630963 AAACACGTGCCTTCAGACAGTGG + Intronic
1011305275 6:85918741-85918763 AACCACGGCCTGTCAGGGGGTGG - Intergenic
1014689173 6:124541140-124541162 AAATACTGGCTGACAGAGGGAGG - Intronic
1015628290 6:135204677-135204699 AAACAATTGCTGTCAGAGAGAGG - Intronic
1016344664 6:143100130-143100152 AAGCCAGTGCTGTCAGTGGGTGG - Intronic
1019448242 7:1082499-1082521 AAACAGGTGCTGTGAGTGGCTGG + Intronic
1025488446 7:61081104-61081126 AAAGATGTTCTGTGAGAGGGAGG - Intergenic
1026408347 7:70092339-70092361 AAACAAATGCTTTCAGAAGGAGG - Intronic
1029173073 7:98644288-98644310 AAGCAGGTGCCGTAAGAGGGAGG - Intergenic
1036576128 8:10029307-10029329 AGACACCTGCTGTCAGGGAGAGG + Intergenic
1045497362 8:102719728-102719750 AAACACATGCTGAAAGTGGGGGG + Intergenic
1047539097 8:125746817-125746839 AAACATGATCTGTCAGAGGGTGG + Intergenic
1049820354 8:144629712-144629734 AGACCTGTGCTGGCAGAGGGTGG + Intergenic
1057481744 9:95449963-95449985 GAACACGCGCTGTGACAGGGTGG + Intronic
1059967907 9:119634192-119634214 AGACACGTCCTGTCTGATGGCGG + Intergenic
1060216696 9:121742740-121742762 AAAAGCGGGCAGTCAGAGGGAGG - Intronic
1061881275 9:133570442-133570464 AAACACGTGCTCTCCTCGGGAGG - Exonic
1186558150 X:10582640-10582662 CAACAGCTGATGTCAGAGGGTGG - Intronic
1189310678 X:40015107-40015129 AAACCCGTGCCGGGAGAGGGGGG + Intergenic
1189489381 X:41457826-41457848 CAACACCTGCTGTCAGACCGTGG + Intronic
1198104149 X:133446819-133446841 AAACACGTACTGTCTGGGTGGGG - Intergenic
1200129355 X:153832468-153832490 AAACACCTGCTGTCACACTGAGG - Intergenic
1200227857 X:154429012-154429034 GAAGAGGTGCTGTCAGACGGGGG - Intronic