ID: 1084325625

View in Genome Browser
Species Human (GRCh38)
Location 11:68398281-68398303
Sequence CACCCTAGCTGTGCTCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084325625_1084325637 25 Left 1084325625 11:68398281-68398303 CCCCTCAGAGCACAGCTAGGGTG 0: 1
1: 0
2: 1
3: 10
4: 153
Right 1084325637 11:68398329-68398351 CCCTCCCAGCTGGCAGCCGGCGG 0: 1
1: 0
2: 0
3: 26
4: 292
1084325625_1084325632 15 Left 1084325625 11:68398281-68398303 CCCCTCAGAGCACAGCTAGGGTG 0: 1
1: 0
2: 1
3: 10
4: 153
Right 1084325632 11:68398319-68398341 TCCCGTCATTCCCTCCCAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 145
1084325625_1084325640 29 Left 1084325625 11:68398281-68398303 CCCCTCAGAGCACAGCTAGGGTG 0: 1
1: 0
2: 1
3: 10
4: 153
Right 1084325640 11:68398333-68398355 CCCAGCTGGCAGCCGGCGGCCGG 0: 1
1: 0
2: 2
3: 24
4: 304
1084325625_1084325635 22 Left 1084325625 11:68398281-68398303 CCCCTCAGAGCACAGCTAGGGTG 0: 1
1: 0
2: 1
3: 10
4: 153
Right 1084325635 11:68398326-68398348 ATTCCCTCCCAGCTGGCAGCCGG 0: 1
1: 0
2: 1
3: 26
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084325625 Original CRISPR CACCCTAGCTGTGCTCTGAG GGG (reversed) Intronic
900255257 1:1694538-1694560 CACCATCGCTGCGCTCTGACCGG - Intronic
900297658 1:1960092-1960114 CAGCCTGACTGTGCTCTGGGTGG - Intronic
900353703 1:2249503-2249525 CACCCATGGTGTGGTCTGAGTGG + Intronic
900652065 1:3734607-3734629 TAACCTTGCTGTGCCCTGAGGGG - Exonic
902330057 1:15726897-15726919 CGCACTAGCTGTGCCCTCAGAGG + Intronic
902734886 1:18394039-18394061 AACCTCAGCTGTGCTCTGAAGGG - Intergenic
903907903 1:26698265-26698287 CATCCTATCTGTGATCTGATTGG + Intronic
905404917 1:37726145-37726167 CATCCTGGCTTTGCACTGAGAGG - Intronic
905592801 1:39179274-39179296 CACCCCAACTCTGTTCTGAGTGG - Intronic
906501570 1:46344908-46344930 CACCATACTTCTGCTCTGAGAGG - Exonic
919922851 1:202176751-202176773 CAGCCTAGCTCTGCCTTGAGAGG + Intergenic
921196281 1:212760572-212760594 CCCCCTAAATGTGCTCTGGGGGG + Intronic
1062954349 10:1530234-1530256 GACCCTCACTGAGCTCTGAGAGG - Intronic
1065777316 10:29132875-29132897 CACCCTCCCCTTGCTCTGAGAGG - Intergenic
1067295086 10:44971133-44971155 AACCCAAGCTGGGCTCTGTGGGG - Intronic
1068437811 10:57015092-57015114 AACCCTAGCTGAGGTCTGAGGGG - Intergenic
1068767329 10:60778382-60778404 CAGCGTAGCTGGGCTCTGATTGG + Intronic
1069096049 10:64261301-64261323 AACTCTAGCTGTGCTTTTAGGGG + Intergenic
1069560077 10:69423006-69423028 CCCCCTAGCAATGCCCTGAGAGG - Intergenic
1070727069 10:78799753-78799775 CACCCATGCTTGGCTCTGAGTGG + Intergenic
1072520269 10:96224622-96224644 CTCACTAGCTGTGCTCTTTGGGG + Intronic
1074831229 10:117250857-117250879 CACCACAGCTGTGCCCTGATGGG + Intronic
1076685266 10:132195803-132195825 CACCCATGCTGTTCTGTGAGTGG + Intronic
1077076651 11:705350-705372 CACCCTGGCCCTGTTCTGAGCGG + Intronic
1078426687 11:11257217-11257239 GAACCTAGCTATGCTCAGAGTGG + Intergenic
1078929579 11:15902665-15902687 CACACTGGCTCAGCTCTGAGGGG - Intergenic
1080569684 11:33544560-33544582 AACCATAGCTGTGCTGTAAGTGG + Intronic
1080609551 11:33892151-33892173 CACACCAGATGTGCTCTGCGTGG + Exonic
1082098341 11:48150225-48150247 AACCCAAGCTGGGATCTGAGGGG + Intronic
1084325625 11:68398281-68398303 CACCCTAGCTGTGCTCTGAGGGG - Intronic
1084486299 11:69450260-69450282 CACCCCATCTCTGCTCTCAGAGG + Intergenic
1085722908 11:78929028-78929050 CACCCCATCTGTGCTCTGGCAGG + Intronic
1087536619 11:99454857-99454879 CAGTCTATCTGTGCTCTGATAGG + Intronic
1090414291 11:126530020-126530042 CTCAAAAGCTGTGCTCTGAGGGG - Intronic
1094214999 12:27931277-27931299 CACCCTAGAAATCCTCTGAGGGG + Intergenic
1098714726 12:73815467-73815489 CAGCCTGGCTGGGCTATGAGGGG + Intergenic
1100428109 12:94506407-94506429 TACCCTAACTGTGCACGGAGCGG - Intergenic
1102266608 12:111491421-111491443 CACCCTAGCTGGTGTCTCAGTGG - Intronic
1104152194 12:126094570-126094592 CACCCATACTGTGCTCTGAAAGG - Intergenic
1104670766 12:130678431-130678453 CACCCACGCTGTACCCTGAGCGG - Intronic
1104990676 12:132622237-132622259 CAAGCCAGCTGAGCTCTGAGGGG + Intronic
1106316702 13:28600603-28600625 CAGCTAATCTGTGCTCTGAGTGG - Intergenic
1108038122 13:46312981-46313003 CACTCTAGCTGGGCTCTGGGAGG + Intergenic
1108422960 13:50269198-50269220 CTCCCAAGCTGTGAGCTGAGGGG - Intronic
1109397356 13:61777543-61777565 CTCCCTGGCCGTGATCTGAGTGG - Intergenic
1110470542 13:75854856-75854878 CACCCTTTTGGTGCTCTGAGGGG + Intronic
1112288690 13:98126048-98126070 CTCTCTCGCTGTTCTCTGAGGGG + Intergenic
1113638366 13:111938004-111938026 TCCCCTAGCTGTGCACTTAGAGG + Intergenic
1113677315 13:112215562-112215584 CACCCTAGCTCTTCTCTGGTGGG + Intergenic
1113899836 13:113790315-113790337 CATCCTAGCTGTGGACTGACCGG + Intronic
1113899843 13:113790379-113790401 CATCCTAGCTGTGGACTGACCGG + Intronic
1113899851 13:113790443-113790465 CATCCTAGCTGTGGACTGACCGG + Intronic
1113899858 13:113790507-113790529 CATCCTAGCTGTGGACTGACCGG + Intronic
1113899881 13:113790699-113790721 CATCCTAGCTGTGGACTGACCGG + Intronic
1119616105 14:76100130-76100152 CACCCTGGCTGTTCCCAGAGAGG - Intergenic
1124628660 15:31325527-31325549 CACCCTTGCTGTGTTCTGAGAGG - Intergenic
1127996596 15:64156517-64156539 CTTCCTGGCTGGGCTCTGAGGGG + Exonic
1129452801 15:75660112-75660134 CTCCCTTACTTTGCTCTGAGGGG + Exonic
1131693686 15:94854114-94854136 CACCCCTTCAGTGCTCTGAGAGG + Intergenic
1132582157 16:689861-689883 CACCCTGGCTGAGCGGTGAGGGG + Exonic
1132995435 16:2820129-2820151 CACCTTTGCTGTGCCCTGCGCGG + Intronic
1133030020 16:3006107-3006129 CACCCGGGCTGGGCCCTGAGAGG + Intergenic
1133872433 16:9701958-9701980 CACCCTTACGGTTCTCTGAGGGG + Intergenic
1136269030 16:29137708-29137730 TTCCCTGGCTGTGCTCTCAGGGG - Intergenic
1137587007 16:49669738-49669760 CAGCCCAGCTGGGCTCTGTGTGG - Intronic
1139275666 16:65725379-65725401 GACCCTGGCTGTGCTCGGTGGGG - Intergenic
1141310677 16:82910820-82910842 CACCCTCACTGTGCTCTGAAAGG - Intronic
1142072336 16:88098075-88098097 TTCCCTGGCTGTGCTCTCAGGGG - Intronic
1144943850 17:18959864-18959886 CACCCAGGCTGAGGTCTGAGGGG - Intronic
1146289188 17:31596033-31596055 CATCCATGCTCTGCTCTGAGAGG - Intergenic
1146376775 17:32299933-32299955 CTCCCAAGCTTTCCTCTGAGAGG + Intronic
1151674986 17:75592658-75592680 CACCCCTGCTGTGCTCTGCAGGG + Intergenic
1152227235 17:79098096-79098118 CATCCCAGCTGTGCTCAGGGGGG - Intronic
1153535850 18:6100841-6100863 CACCCTAGCAGAGCTGGGAGGGG + Intronic
1153940132 18:9969927-9969949 CACCCTAAATGTGCACTGAAGGG - Intergenic
1157547210 18:48554918-48554940 AGCCCTGGCTGTGATCTGAGAGG + Intronic
1159167760 18:64724682-64724704 CACTATAGCTGAGCTCTGAGCGG + Intergenic
1160424010 18:78768001-78768023 CTCCCCAGCTTGGCTCTGAGGGG + Intergenic
1162753188 19:12841154-12841176 CACCCGAGCTGGGGCCTGAGGGG + Intronic
1165070033 19:33249616-33249638 CCCCCTCGCTGTGCCCTGGGGGG + Intergenic
1167439298 19:49499279-49499301 CACCCCAGCGGTCCTCGGAGGGG + Intronic
1167948441 19:53008047-53008069 CACCCTGGCTGTGCAGTGACTGG + Intergenic
925825518 2:7844814-7844836 CTCCCTAGCTGTGATGGGAGGGG - Intergenic
926060241 2:9800630-9800652 CACTCAAGCTGGGCTCCGAGAGG - Intergenic
933340967 2:81025655-81025677 CACCCTAGCTGTGTCCACAGTGG + Intergenic
933810687 2:86031181-86031203 AGGCCTGGCTGTGCTCTGAGTGG + Intronic
937249132 2:120512275-120512297 CACCCAAGCTGGGGTCTGAATGG - Intergenic
939296582 2:140273581-140273603 CACCCTTGGTGAGCTCTCAGCGG + Intronic
946437727 2:219669120-219669142 CAGCCTACCTGTCCTCAGAGAGG - Intergenic
947091420 2:226515899-226515921 CAACCTGCCTGTTCTCTGAGAGG - Intergenic
948337458 2:237221599-237221621 CACCCAAGCTCTGCTCAGAAGGG + Intergenic
1169698878 20:8424218-8424240 CACTCTTGCTCTGCTCTGTGTGG - Intronic
1169781339 20:9314019-9314041 CCTCTTAGCTGTGCTTTGAGTGG - Intronic
1170392665 20:15892131-15892153 CACCCCTGCTGTGCTCTGGGAGG - Intronic
1172690551 20:36786517-36786539 CACCCCAGCTGGACTCTGAAGGG + Exonic
1174376541 20:50129937-50129959 CTCCCTACCTGTGCTGTAAGGGG + Intronic
1175369903 20:58481376-58481398 CACCCTTTCTGGGTTCTGAGGGG - Intronic
1179727880 21:43350451-43350473 CACCCCAGATCTGGTCTGAGTGG - Intergenic
1179731899 21:43372758-43372780 CACCACTGCTGTCCTCTGAGGGG - Intergenic
1182325298 22:29508129-29508151 CACCCTATTTGTGCTTTGCGGGG - Exonic
1183639452 22:39084163-39084185 CACTCCTGCTGTGCTCTGAGAGG + Intronic
1183834108 22:40437843-40437865 AACCCTTGCTGTGCTCTGATGGG - Intronic
1184763669 22:46560687-46560709 CACCCTAGGTGTGCAGTGAGGGG + Intergenic
1184851690 22:47124809-47124831 CACACCAGCTGTGCTCAGACTGG - Intronic
1185253832 22:49820733-49820755 CTGCCTTGCTGTGGTCTGAGAGG - Intronic
953295368 3:41710448-41710470 TACCCTAGCCCTGCTTTGAGTGG - Intronic
954143034 3:48620174-48620196 CAACCTGGCTGAGCCCTGAGGGG - Intergenic
956971380 3:74530745-74530767 TACCCTAGCTTTCCTCTGTGAGG - Intergenic
960490514 3:118312264-118312286 CATCCTAGCTGTGGTCCAAGAGG + Intergenic
961382198 3:126503111-126503133 CACTCCAGGTGTGCTGTGAGGGG - Intronic
961738440 3:129016836-129016858 CTCCCAAGCAGTGCTGTGAGTGG + Intronic
967197382 3:187040268-187040290 CATCCCTGCTGTGCACTGAGTGG - Intronic
967272300 3:187741627-187741649 CACCCTCGCTGTGCTCGCGGCGG + Intronic
968873234 4:3252092-3252114 AACCCAACCTGTGCTCGGAGTGG - Intronic
969035878 4:4253409-4253431 CAAACTAGCTGTACTGTGAGAGG + Intergenic
975671340 4:76784109-76784131 CAGCCTGGCTGTGCACAGAGTGG + Intergenic
975823201 4:78292619-78292641 CAGCCTGGCTGTGCCCTGGGTGG + Intronic
981401045 4:144313991-144314013 CACCCTAGCTGCCCTCTGGATGG + Intergenic
988291462 5:29293971-29293993 CACAGTAGCTGTGTTCTGGGAGG - Intergenic
990497928 5:56367429-56367451 CACTTTAGCTGTTCTCTGAGGGG - Intergenic
996019990 5:118580248-118580270 GACCCTGGCTGTGGTCTGGGTGG - Intergenic
998164275 5:139833816-139833838 CCCACTAGCTGTGCCCTGAATGG + Intronic
999734252 5:154500791-154500813 AACCATAGCAGAGCTCTGAGTGG + Intergenic
1001078226 5:168645944-168645966 GACCCTAGCTATGATCTGAAAGG + Intergenic
1001443540 5:171764426-171764448 CACACTTGCTGTGCTCTATGAGG - Intergenic
1002937450 6:1685673-1685695 CAACCTCCCTGTGCTCTGTGCGG - Intronic
1003264415 6:4552760-4552782 CACCCTACCTCTCCTCTGGGAGG + Intergenic
1003642878 6:7890332-7890354 CACCTTAGCTGCTCTCTGACGGG - Intronic
1003928684 6:10902012-10902034 AGCCCTAGCTTTGCTCTGATTGG + Intronic
1006456847 6:34136909-34136931 CACCCTGCCTCTGCTCTCAGTGG - Intronic
1006521805 6:34575176-34575198 CATCTGAGCTGTGATCTGAGGGG + Intergenic
1015096950 6:129427277-129427299 CACTCTAGTTGTGGACTGAGAGG - Intronic
1018944136 6:168334017-168334039 CATCCTCGCTGTGGTCTGTGGGG + Intergenic
1021344007 7:19500532-19500554 CACAATAGCTGTACTCTGATTGG - Intergenic
1022981561 7:35609511-35609533 CACTCTAGCTGTGGTGAGAGTGG - Intergenic
1024534637 7:50420016-50420038 TACCCCAGATGTGCTCTGACTGG - Intergenic
1024930207 7:54661073-54661095 GACCCAAGCTGTGCACAGAGGGG - Intergenic
1029142149 7:98418961-98418983 CACCCTAGCTTAGCTCTCTGAGG + Intergenic
1031457984 7:122007982-122008004 CACCCTCACTGGGTTCTGAGAGG + Intronic
1034416763 7:150969390-150969412 CACCTCAGCTGTGCTCTCTGTGG + Intronic
1037163741 8:15801721-15801743 TACCCTTGCTGGGCTCAGAGGGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1040794798 8:51277500-51277522 CATGCAAGCTGTGCTCTTAGCGG + Intergenic
1040977268 8:53207748-53207770 CACCACAGCTGGGCCCTGAGGGG - Intergenic
1043931263 8:86094034-86094056 CATCATAGTTCTGCTCTGAGGGG + Intronic
1045255539 8:100517638-100517660 CAGCCTATGTGTGCTTTGAGGGG + Intronic
1045646412 8:104304152-104304174 CACCAAAGCTGGGCACTGAGTGG + Intergenic
1046906380 8:119577911-119577933 CTCCATTGCTCTGCTCTGAGTGG - Intronic
1048885896 8:138909603-138909625 AACCCTGGCTGTGTTCTGATGGG - Intronic
1048923963 8:139254202-139254224 GAAGATAGCTGTGCTCTGAGAGG + Intergenic
1049024570 8:139979784-139979806 CCCCCTGGCAGTGCTGTGAGGGG - Intronic
1049070615 8:140352714-140352736 AACTCTAGCAGTGCTCTGACTGG - Intronic
1050297429 9:4219787-4219809 CACCCCTGCTTTGCTCTGCGTGG - Intronic
1052339857 9:27354236-27354258 CACCCTATCAGGCCTCTGAGTGG - Intronic
1052739706 9:32381822-32381844 CACCCCAGCTGTGCTCTGGTGGG - Intergenic
1052784767 9:32818266-32818288 CACACTAGCTGTGGTGTGACTGG - Intergenic
1053195974 9:36118879-36118901 CGACGGAGCTGTGCTCTGAGAGG - Exonic
1059995503 9:119904930-119904952 TAGCCTATGTGTGCTCTGAGGGG + Intergenic
1060168765 9:121443249-121443271 CACCATGGCCGTGCACTGAGCGG - Intergenic
1061282950 9:129607875-129607897 CACCCGTGCTGGGCCCTGAGTGG - Intergenic
1062483223 9:136762093-136762115 CACACTGCCTGTGCTGTGAGGGG + Intronic
1203496304 Un_GL000224v1:154764-154786 CACCTCAGCTGTGGTCTGAATGG - Intergenic
1203508926 Un_KI270741v1:96686-96708 CACCTCAGCTGTGGTCTGAATGG - Intergenic
1190130867 X:47747786-47747808 CACCATTGCTATGCACTGAGGGG + Intergenic
1195245919 X:102994941-102994963 CAGCCTAGCTGTGATCAGAATGG - Intergenic