ID: 1084326706

View in Genome Browser
Species Human (GRCh38)
Location 11:68404475-68404497
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084326698_1084326706 8 Left 1084326698 11:68404444-68404466 CCGTCGGGTGGATGTGATGTCAG 0: 1
1: 1
2: 0
3: 3
4: 72
Right 1084326706 11:68404475-68404497 CTTTAAAATACGAGGGAGCTGGG 0: 2
1: 0
2: 1
3: 13
4: 108
1084326697_1084326706 9 Left 1084326697 11:68404443-68404465 CCCGTCGGGTGGATGTGATGTCA 0: 1
1: 1
2: 0
3: 3
4: 62
Right 1084326706 11:68404475-68404497 CTTTAAAATACGAGGGAGCTGGG 0: 2
1: 0
2: 1
3: 13
4: 108
1084326693_1084326706 26 Left 1084326693 11:68404426-68404448 CCGGGTTGACTCTGCTGCCCGTC 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1084326706 11:68404475-68404497 CTTTAAAATACGAGGGAGCTGGG 0: 2
1: 0
2: 1
3: 13
4: 108
1084326692_1084326706 27 Left 1084326692 11:68404425-68404447 CCCGGGTTGACTCTGCTGCCCGT 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1084326706 11:68404475-68404497 CTTTAAAATACGAGGGAGCTGGG 0: 2
1: 0
2: 1
3: 13
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902514740 1:16984008-16984030 CTTGAAAAAAGGAGGGAGGTTGG + Intergenic
902605674 1:17567949-17567971 CTTTAAAAGAGGAAGGGGCTGGG + Intronic
906315839 1:44786022-44786044 CTTTAAAATTAGAGGGAGGAGGG + Intronic
910185875 1:84539094-84539116 CATTAAAACACTAGTGAGCTGGG - Intergenic
910221897 1:84896427-84896449 CTTTAGCATACGTGTGAGCTTGG + Intergenic
910750574 1:90625890-90625912 CTTTAAAATAAAAGAGAGTTGGG - Intergenic
911790187 1:102005124-102005146 CTTTAAAATACAACTCAGCTAGG - Intergenic
915946081 1:160152734-160152756 CTGTAAAATAGTGGGGAGCTAGG + Intronic
917897007 1:179501414-179501436 ATTAAAAATACTAGGGGGCTGGG + Intronic
917975729 1:180236368-180236390 CATTAAAATCCGAGGCAACTGGG - Intronic
920632305 1:207664354-207664376 CTTTAAAATATTAGGGAGATAGG - Intronic
920642659 1:207768904-207768926 CTTTAAAATATTAGGGAGATAGG - Intronic
923069539 1:230549911-230549933 CTCTAAAACATGAGGGAGGTGGG - Intergenic
923774634 1:236967413-236967435 CTACAAAAGATGAGGGAGCTTGG + Intergenic
1063882777 10:10548169-10548191 ATTTAAGAGACGAGGGAACTGGG - Intergenic
1065538204 10:26735141-26735163 CCTTAAAATAGGAGGCAGCGGGG - Intronic
1067012833 10:42730657-42730679 CTTTAAGATAGGAGACAGCTAGG - Intergenic
1068584112 10:58777350-58777372 GTTTAAAATACAAGGATGCTGGG - Intronic
1069869908 10:71526795-71526817 CTTTTAAAAATGAGGAAGCTGGG + Intronic
1078224910 11:9383267-9383289 CTCTAAAAAAAGAGGGAGGTGGG - Intergenic
1082738805 11:56887601-56887623 CATTAAAATATGAGGGAGCCAGG + Intergenic
1084326706 11:68404475-68404497 CTTTAAAATACGAGGGAGCTGGG + Intronic
1090089715 11:123684250-123684272 CTTTAAAATTCGAGGGAGGTAGG + Intergenic
1090452805 11:126821503-126821525 CTTTTATAAATGAGGGAGCTGGG - Intronic
1090471217 11:126982863-126982885 CTTTAAAATACTATAGACCTTGG - Intronic
1093981157 12:25477264-25477286 TTTTAACATACGAAGGAGCTGGG + Intronic
1095490790 12:42731828-42731850 CTTGAAAATAAGAGGGAGAAAGG - Intergenic
1102486143 12:113258780-113258802 CTTAAAAAAAGCAGGGAGCTGGG + Intronic
1102574568 12:113848078-113848100 CTTTTACATATGAGGAAGCTCGG - Intronic
1103196657 12:119049457-119049479 CTTTATAATATGAGTGAGATAGG + Intronic
1105531083 13:21221065-21221087 CTTTGCAATATGAGGGAACTAGG + Intergenic
1107649643 13:42531688-42531710 CTTTAGAAGAAGAGGGAGATGGG - Intergenic
1114304380 14:21408245-21408267 CCTTAAAATACCAGGTACCTTGG + Intronic
1117687296 14:58267161-58267183 CTTAAAAATACAAAAGAGCTGGG - Intronic
1120827761 14:88970601-88970623 CTTTAAAACAGGAGGGAGGCCGG + Intergenic
1124990467 15:34668525-34668547 CTTTAAAAAGGGAGTGAGCTAGG + Intergenic
1128243936 15:66120104-66120126 CTTTGAAATTGGAGTGAGCTAGG - Intronic
1129263841 15:74383488-74383510 ATTTAAAATACCAGGGGGCTAGG + Intergenic
1131811000 15:96172758-96172780 TTTTAAAAAACGAGTGAGCAAGG + Intergenic
1132274185 15:100552366-100552388 CTTTAAAAGACCATGAAGCTGGG - Intergenic
1137390242 16:48075262-48075284 CTTCCCAAAACGAGGGAGCTGGG + Intergenic
1138615414 16:58161633-58161655 CTTAAAATTTCGGGGGAGCTAGG + Intronic
1138683388 16:58703835-58703857 CTTAAAAAAAAGGGGGAGCTGGG - Intergenic
1142063703 16:88047756-88047778 ATTTAAAATACCAGTGAGCTAGG + Intronic
1146930293 17:36772103-36772125 TTTAAAAATACAAGGGAACTTGG - Intergenic
1149968882 17:61195673-61195695 CTTTAAAAAACGAGGGGGGCCGG - Intronic
1158619875 18:59023634-59023656 CTTTAACATAACAGGGAGTTGGG + Intergenic
1160206660 18:76840192-76840214 CTTTAAAAAATGAGGGAGACCGG + Intronic
1161859363 19:6786297-6786319 TTTTAAAACACGAGGCAGCTTGG - Intronic
1165020550 19:32920778-32920800 CTATAAAATAAGAGGGAGGCTGG - Intronic
926462503 2:13149278-13149300 CTTTAAAATAACAGGGATATGGG - Intergenic
930065213 2:47322711-47322733 CTTTAAAATAAGGGTCAGCTGGG + Intergenic
933848475 2:86346611-86346633 CTTAAAAAAATGTGGGAGCTGGG - Intergenic
935681044 2:105637248-105637270 CTTTAAAAAACCAGAGAGTTAGG - Intergenic
941795876 2:169597792-169597814 TTTTAAAAGAAGAGAGAGCTGGG - Intronic
942588748 2:177517489-177517511 CTTTTAACTTCGAGGGAGTTTGG + Intronic
944032021 2:195245897-195245919 CTGTATACTACTAGGGAGCTAGG + Intergenic
945255876 2:207802581-207802603 ATGAAAAATACAAGGGAGCTGGG - Intergenic
945704650 2:213213979-213214001 ATTTAAAAAATGAGGGCGCTCGG - Intergenic
947168753 2:227289835-227289857 CCTTCAAATAAGAGGGAACTAGG - Intronic
948110803 2:235454107-235454129 TTTTAAACTATGAGGCAGCTGGG + Intergenic
948200417 2:236125974-236125996 GTTTAACATACGAGAGAGCGAGG - Exonic
1169199722 20:3703007-3703029 ATATAAAATAGGAGGGAACTAGG + Intronic
1171462372 20:25305659-25305681 CTTTAAAAAAAGAGGGAAGTAGG - Intronic
1172258686 20:33542352-33542374 CTGTAAAATACTAGGTAGCCAGG - Intronic
1173552775 20:43944897-43944919 CTTTGAAATAAGACAGAGCTGGG - Intronic
1181801984 22:25353778-25353800 CTTTAAAATACGAGGGAGCTGGG - Intronic
949373595 3:3362717-3362739 TTTTAAAATGAGAGGGAGGTAGG + Intergenic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
952286038 3:31970641-31970663 CTTTAAAATGAGATGGAGGTGGG - Intronic
952636899 3:35543962-35543984 CTTTAGAATATGAAGGAGCAGGG - Intergenic
952771505 3:37005758-37005780 CTTTAGAATACATGGCAGCTGGG - Intronic
953049770 3:39330113-39330135 CTTTATAATACCAGGCATCTGGG + Intronic
955543738 3:60005217-60005239 CGTGAAAATACTAGGGAGCTTGG + Intronic
955550150 3:60075261-60075283 CTTTAAAATGCTAGGGTGATGGG + Intronic
962829205 3:139124779-139124801 CTTTAAAATAATAGGGAGGTTGG + Intronic
963909782 3:150806892-150806914 CTTTCAGATACGAGGGGACTAGG + Intergenic
964233242 3:154495385-154495407 CTTTAATGTGCAAGGGAGCTGGG - Intergenic
971751293 4:30652225-30652247 CTTGAAAATCCAAGAGAGCTTGG - Intergenic
973709626 4:53615462-53615484 CTCTCATACACGAGGGAGCTAGG - Intronic
975482378 4:74895327-74895349 CTTTATAATTCCAGGGAGGTTGG - Intergenic
981110428 4:140928236-140928258 CATTAGAATAAAAGGGAGCTTGG + Intronic
982824735 4:159988642-159988664 CTTATAAATACAAGGGAGTTAGG + Intergenic
984186242 4:176547054-176547076 CTTTAAACTACAAGGCAGCTGGG - Intergenic
985995135 5:3593510-3593532 CCTCAAAACACCAGGGAGCTGGG - Intergenic
986681924 5:10241211-10241233 CTATAAATTAAGAGGGAGCCAGG - Intronic
988162272 5:27534148-27534170 CTTTCAAATAAAATGGAGCTTGG + Intergenic
988803501 5:34718745-34718767 ATTTTAAAGACGAGGAAGCTGGG - Intronic
989438041 5:41437580-41437602 CTTTAAAGTAGGAAGGAGCTTGG + Intronic
991203911 5:64027362-64027384 CTTTAAGAAAAGATGGAGCTTGG + Intergenic
995214863 5:109583536-109583558 CCTTAAAATAAAGGGGAGCTTGG - Intergenic
998456531 5:142278137-142278159 CTTTAAAATACTAGGGAGTGGGG + Intergenic
999582319 5:153052591-153052613 CTTTAAAAAAGCATGGAGCTGGG + Intergenic
1000779624 5:165464865-165464887 CTTTAGTTTACGTGGGAGCTGGG + Intergenic
1003391577 6:5717862-5717884 CTTTGCAATATGAGGGAACTAGG - Intronic
1006483160 6:34314952-34314974 CTTTAAAATCAGAGGCACCTAGG - Intronic
1006693079 6:35907403-35907425 CTTTAAAATAAGATGGAGTGAGG + Intronic
1006799899 6:36753096-36753118 CTTCAAAACAAAAGGGAGCTTGG + Intronic
1009623973 6:66112899-66112921 CTTTAAAATATGAGTGATCAAGG + Intergenic
1011604851 6:89092996-89093018 CTTTAAAATAAGAAGGGGCCAGG - Intergenic
1015175482 6:130302915-130302937 CTTTAAAATTTGAGGGGGCAAGG + Intronic
1017063846 6:150510305-150510327 CTTTACAAGCAGAGGGAGCTGGG + Intergenic
1017651534 6:156587880-156587902 TTTTAAAATATGTGGAAGCTGGG + Intergenic
1017991805 6:159495253-159495275 GGTTTAAATAAGAGGGAGCTAGG - Intergenic
1018423450 6:163660184-163660206 CTTCTAACTACGGGGGAGCTGGG + Intergenic
1018801928 6:167229647-167229669 CTTCACATTACGAGAGAGCTTGG + Intergenic
1018927657 6:168217585-168217607 CTTTAAAATGCCAGGCTGCTGGG + Intergenic
1021973748 7:25991046-25991068 TTTTAAAAGATGAGAGAGCTAGG - Intergenic
1023661869 7:42478474-42478496 CTTTAAAAGATGAGGAAGTTTGG + Intergenic
1023795843 7:43791238-43791260 CTCTGAAATAGAAGGGAGCTCGG + Exonic
1029636980 7:101791155-101791177 TTTAAAAACAAGAGGGAGCTGGG - Intergenic
1032069119 7:128792762-128792784 TTTTAAAATAAGAGACAGCTTGG - Intronic
1032143309 7:129354248-129354270 CATTAAAACAGGAGGGAGATAGG + Intronic
1033007122 7:137578403-137578425 CTGTAGGATAGGAGGGAGCTGGG - Intronic
1033236359 7:139640909-139640931 CTTTAAAAAATGAGGAAGCTGGG - Intronic
1033458043 7:141520045-141520067 CTTCAAAATGCTAGGTAGCTGGG + Intergenic
1042693970 8:71535261-71535283 CTTTAAAATAAGAGAGACTTAGG - Intronic
1044452063 8:92348144-92348166 ATTTATAAGACGAGGAAGCTTGG - Intergenic
1047963763 8:130030270-130030292 ATTTAAAAAATGGGGGAGCTAGG + Intergenic
1058179778 9:101782936-101782958 CTTTAAAATATGAGAGAGACTGG - Intergenic
1059226259 9:112675765-112675787 TGTTAAAATTCGAGGAAGCTGGG + Intergenic
1194915687 X:99705513-99705535 CTTTAAAATACAAAGGAGTGGGG + Intergenic
1196307447 X:114121361-114121383 CTTTTAAATAAGATGGTGCTAGG + Intergenic
1201589836 Y:15602998-15603020 CCTGCAAATATGAGGGAGCTAGG + Intergenic