ID: 1084327547

View in Genome Browser
Species Human (GRCh38)
Location 11:68410527-68410549
Sequence CAAAGCAAGGAGACCTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084327547_1084327552 16 Left 1084327547 11:68410527-68410549 CCTGACCAGGTCTCCTTGCTTTG 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1084327552 11:68410566-68410588 ATGATCCAGAACTGACTTTGAGG 0: 1
1: 0
2: 0
3: 14
4: 156
1084327547_1084327554 23 Left 1084327547 11:68410527-68410549 CCTGACCAGGTCTCCTTGCTTTG 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1084327554 11:68410573-68410595 AGAACTGACTTTGAGGTCCCCGG 0: 1
1: 0
2: 1
3: 10
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084327547 Original CRISPR CAAAGCAAGGAGACCTGGTC AGG (reversed) Intronic
900721641 1:4179900-4179922 CCAAGCAGGGAGACTTGGTCGGG + Intergenic
902597786 1:17520936-17520958 CCAAGGAAGGAGCCCTGGGCGGG - Intergenic
903312004 1:22465886-22465908 TGAAGCAAGGAGGCCTGGGCAGG - Intronic
903673825 1:25052179-25052201 GAGAGTAAGGAGAGCTGGTCTGG - Intergenic
905141736 1:35851423-35851445 AAAAGCAAAGTGAACTGGTCAGG - Intronic
905486083 1:38297898-38297920 GAAAGGAAGGAGAACTGGGCTGG - Intergenic
905923882 1:41736419-41736441 CAAAGCCAGGAAGCCTTGTCAGG - Intronic
910922553 1:92364774-92364796 CACGGCAAGGAGACCTGCTTGGG - Intronic
914256656 1:145965451-145965473 GAAAGCAAGGAGAACTGGAATGG + Intronic
914450794 1:147789650-147789672 CAAAGCAAGGAGGCCGGGTGTGG + Intergenic
915302004 1:154957006-154957028 AACAGCAAGGAGTCCTTGTCTGG + Exonic
915718935 1:157969599-157969621 AGAAGCAAGGAGAGCTGGCCTGG + Intergenic
917496820 1:175548028-175548050 AAAGGCAAAGAGACCTGGTGGGG + Intronic
919740250 1:200976967-200976989 CAAAACAAATAGGCCTGGTCAGG + Intronic
919761244 1:201099487-201099509 CAAGGCATGGTGACCTGCTCAGG + Intronic
919810652 1:201407010-201407032 TAAAGGCAGGAGACCTGCTCTGG - Exonic
920867633 1:209766566-209766588 TAAAGGAAGGAAACCTGGCCAGG + Intronic
921161706 1:212477371-212477393 CAGAGCAAGAAGAGCAGGTCTGG - Intergenic
922317338 1:224454327-224454349 CAAAGCTAGGAGGCTTGGTAAGG + Intronic
922955747 1:229597939-229597961 CCAAGAAAGGACCCCTGGTCTGG - Intronic
923084952 1:230696111-230696133 CAAAGAAAGGAGAGATGTTCTGG - Intergenic
923181718 1:231526636-231526658 TAAAACAAGGAGACCAGGTAGGG + Intergenic
923828322 1:237525115-237525137 CAAAGCAAGGAGAGCAGGAGGGG - Intronic
923913044 1:238471256-238471278 CAAAGCAAGGTGACGTGATTTGG + Intergenic
1063762476 10:9095886-9095908 GAAATCATGGAGACCAGGTCAGG - Intergenic
1064406560 10:15069432-15069454 CAATGAGAGCAGACCTGGTCAGG + Intronic
1065325282 10:24545353-24545375 CAAAGAAAAGCCACCTGGTCTGG - Intronic
1067948763 10:50709659-50709681 AAGAGCCAGGAGACCTGGCCTGG - Intergenic
1069286059 10:66716841-66716863 CAAAGCAAAAAAACTTGGTCAGG + Intronic
1069729149 10:70599999-70600021 CAGAGGCAGGAGACCTGGCCGGG - Intronic
1070171426 10:73935769-73935791 CAGAGCAGGGTGCCCTGGTCTGG - Intergenic
1072390714 10:94983406-94983428 AAAAGCAATGAGACTTGGTAAGG + Intronic
1075822410 10:125326121-125326143 GAAAGAAAGAAGACCAGGTCTGG - Intergenic
1076012957 10:127005039-127005061 CTAAGAAAGGATACTTGGTCGGG + Intronic
1076472593 10:130729205-130729227 CCAAGAAAGGAGGCCTGGTGTGG + Intergenic
1077199959 11:1301784-1301806 CACAGCAGGAAGACCTGGGCTGG + Intronic
1079013894 11:16852359-16852381 CAAAGCAAAGAAAACTAGTCAGG + Intronic
1080644533 11:34178643-34178665 CAGAGCCAGGAGACCGGGTCGGG + Intronic
1083015877 11:59453700-59453722 CAAAGCAAAGATACATAGTCAGG + Intergenic
1083802432 11:65054216-65054238 CAACTGAGGGAGACCTGGTCTGG + Intronic
1083982312 11:66182779-66182801 CAAAGCAACTAGACCAGGTATGG - Intronic
1084170981 11:67401037-67401059 GAAGGCAAGGGGACCTGGGCCGG + Intronic
1084327547 11:68410527-68410549 CAAAGCAAGGAGACCTGGTCAGG - Intronic
1084855837 11:71985597-71985619 CACAGCAAGGAGGCATGGGCAGG + Intronic
1086515707 11:87610654-87610676 AAAAGCAAGGAGTGCTGGTGAGG + Intergenic
1089841555 11:121423166-121423188 AAAAGAAAGGAAATCTGGTCAGG - Intergenic
1096128275 12:49136153-49136175 CAAAACAAATAGACCTGGCCGGG - Intergenic
1096380248 12:51150988-51151010 GAAAGCAAGGAGTGCTGGTGAGG + Intronic
1098139608 12:67438310-67438332 CTAAGAAAGGATACCTGGGCCGG + Intergenic
1098270893 12:68769358-68769380 AAAAGAAAGGAGACCTTGGCCGG + Exonic
1099508851 12:83509122-83509144 CAAAGCAAGGAGAGCTGGAAAGG + Intergenic
1101293526 12:103396658-103396680 CAAAACCAGTAGACCTGGTCTGG - Intronic
1101345797 12:103885151-103885173 CACAGGAAGGAGACCTGGATTGG - Intergenic
1102257477 12:111424641-111424663 CAAAGCAAGCAGCCCTGGGGAGG + Intronic
1103501041 12:121402140-121402162 CTAAGCAAGTATACCTGGCCGGG + Intronic
1104432628 12:128729005-128729027 GAAAGCAAGGAGCACAGGTCTGG - Intergenic
1104649810 12:130523446-130523468 TAAAGCAACGAGACATGGACAGG + Intronic
1105658657 13:22469006-22469028 CACAGCAAGAAGATGTGGTCTGG + Intergenic
1105753616 13:23444687-23444709 AAAAACAAGGAGAACTGGTGTGG + Intergenic
1106508199 13:30390180-30390202 AAAAGCAAGGAGTCCAGGTGTGG + Intergenic
1107714140 13:43181810-43181832 CAAAAAAATGAGCCCTGGTCAGG - Intergenic
1116757861 14:48970324-48970346 AAAAGCAAGGTTTCCTGGTCTGG + Intergenic
1117129085 14:52666638-52666660 CAAAGGAAGGAGGCCGGGTGTGG + Intronic
1117790240 14:59332681-59332703 CACAGCAAGGTGGCCAGGTCTGG + Intronic
1118488643 14:66237668-66237690 CAAAGCCAGGTGACATGGGCTGG - Intergenic
1120818675 14:88891490-88891512 AAAAGCAAGGAGCCTTGTTCTGG - Intergenic
1122480855 14:102046453-102046475 CAAAGCCAGGCGAGCTGGGCGGG + Intronic
1124163351 15:27294974-27294996 AAGAGGAAGGAGACCTGGCCAGG + Intronic
1124197420 15:27644665-27644687 CTCAGCAGGGAGACCTGGTGGGG + Intergenic
1127649763 15:60995503-60995525 TGAAGGAAGGAGACCTGGTCAGG - Intronic
1129557836 15:76531986-76532008 GAGAGCAAGGATACCTGGTGGGG - Intronic
1129657893 15:77536882-77536904 CAAAGCTAGGAGAGCTGTTTGGG + Intergenic
1131444119 15:92481718-92481740 GATAGCAAGGAGAACTGTTCTGG + Intronic
1132929894 16:2453725-2453747 CTGAGGAAGGAGACCTGGGCTGG - Intronic
1134026516 16:10958187-10958209 CAAAGGAAGGAGAACATGTCTGG + Intronic
1137428176 16:48397525-48397547 CAAAGCAGGAAGAACTGGACTGG + Intronic
1139022514 16:62768069-62768091 CATATGAAGGAGACCTGGGCAGG - Intergenic
1140453515 16:75090511-75090533 CAAAGCTAGAAGACCAGGCCTGG - Intronic
1141168240 16:81674884-81674906 CAAAGAAAGAAGCCCTGATCTGG - Intronic
1141466010 16:84206232-84206254 CAAAGTAAGGAGATGAGGTCAGG - Intergenic
1141613804 16:85198731-85198753 CAAAACAAGGAGGCCTGGCAAGG - Intergenic
1144053246 17:11515791-11515813 TCAACCAAGGAGACCTGGGCAGG + Intronic
1145065029 17:19756236-19756258 CAAAGAATGGAGATCTGGTGGGG - Intergenic
1145215436 17:21048039-21048061 CAAAGCAGGCAGACCTAGTTAGG + Intergenic
1149540127 17:57462381-57462403 CAAAGAAAGGAGTCCTGGCAGGG - Intronic
1150295261 17:64003975-64003997 CAAAGGAGGGAGGTCTGGTCAGG + Intronic
1150616936 17:66779562-66779584 CAAATCACGGAAACCTGGGCTGG - Intronic
1153762208 18:8342093-8342115 GAAAGGAAGGAGGCCTGGACAGG + Intronic
1155089020 18:22488325-22488347 AAAAGCAAGGTGACCTGGCAAGG + Intergenic
1155468988 18:26170945-26170967 CAAATAAAGTAGACATGGTCTGG - Intronic
1155913632 18:31534352-31534374 CAAAGCAAGGAGAATTAGTGTGG - Intronic
1156554746 18:38054452-38054474 AATAGCAAGGTGACATGGTCTGG + Intergenic
1156573629 18:38286685-38286707 CAAAGCAAGGAGAATAGGTAAGG - Intergenic
1157519359 18:48334758-48334780 AAAAGCAAGGGGACATGGTAAGG + Intronic
1158429239 18:57369353-57369375 CAGAGGAAGGAGAACTGGACAGG - Intronic
1160238441 18:77104381-77104403 CAAAGGAAGGAGAACTGGTGAGG + Intronic
1160603672 18:80033596-80033618 CGAAGCCTGGAGACCTGGGCAGG - Intronic
1163127898 19:15254270-15254292 CCAAGCAATGGGAGCTGGTCAGG + Intronic
1165459321 19:35935294-35935316 CACTGCAAGGACACCTGGCCTGG + Intergenic
1166042598 19:40212883-40212905 CAAAGAAGGAAGAACTGGTCGGG + Exonic
1167456472 19:49598948-49598970 AAAAGCAAGCAGACCGGGTGAGG - Intronic
1167864801 19:52315875-52315897 CAAAGGAGGGAGCCCTGGTCTGG + Exonic
927496134 2:23553195-23553217 CAAAGCAACAGGACCTGGTTAGG + Intronic
928885649 2:36145131-36145153 CAAAGGAAGGAAACCTGGAAAGG - Intergenic
929542027 2:42829928-42829950 CACAGCTAGGAGACTTGGTGGGG - Intergenic
929655129 2:43723429-43723451 CAAGGCAAAGAGACTTGGGCTGG + Intronic
930012475 2:46948036-46948058 CCAAGCGAGGAGCTCTGGTCCGG + Intronic
930510303 2:52336023-52336045 GAAGGCAAGGACACCTGGTGGGG - Intergenic
932435310 2:71699759-71699781 CAAAGGAAGGGGACTTGGACAGG + Intergenic
932734845 2:74247337-74247359 CACAGCCAGGAGCCCTGGGCTGG - Intronic
934528358 2:95067687-95067709 CAAAGCAAGGATGCCTGCTTTGG - Intergenic
935201633 2:100861606-100861628 CACAGGAAGGAGGCCTGGGCTGG + Intronic
935469726 2:103443665-103443687 CACAGCAAGGAGACTTGACCAGG + Intergenic
936820946 2:116520419-116520441 CAAAGCAAGGAAACGTGTTCAGG + Intergenic
937014695 2:118594518-118594540 AAAAGAAATGAGACCTGGCCTGG + Intergenic
937802082 2:126092000-126092022 CAACATAGGGAGACCTGGTCTGG - Intergenic
941860822 2:170278234-170278256 TCAAGCAGGGAGACCTGCTCTGG - Intronic
942044228 2:172090160-172090182 AAAAGCAGGGAGGCCTGATCCGG - Intergenic
943721272 2:191205750-191205772 GAAAGCAAAGAGACCGGGTGCGG - Intergenic
945055978 2:205869342-205869364 CAATGCTAGGAGACAAGGTCTGG - Intergenic
946194266 2:218023784-218023806 CAAAACAAGGAGGGCTGGTGGGG - Intergenic
948205019 2:236159058-236159080 CAGAGCAACCAGACCTGGGCAGG - Intergenic
1168838138 20:891410-891432 CAAGGGCAGGAGAGCTGGTCTGG + Intronic
1170305394 20:14932317-14932339 CTAAGCAAGGAGACCTGCCCTGG + Intronic
1170355495 20:15488024-15488046 CAAAGCTAAGAGACCCTGTCTGG + Intronic
1171306411 20:24110518-24110540 CAATACAAGGAGAGCTGGTCTGG - Intergenic
1171322553 20:24259107-24259129 CAAATGTAGGAGTCCTGGTCTGG - Intergenic
1172940715 20:38652399-38652421 TAAACCAAGGAGACCTAGTAAGG + Intergenic
1173337545 20:42125008-42125030 CAAGGCATGGAGACCTGGCAGGG - Intronic
1173736446 20:45364783-45364805 TAAAGCCAGGAGACCTGGGATGG + Intronic
1174278311 20:49419774-49419796 CAAAGAAAAGTGCCCTGGTCTGG - Intronic
1174495744 20:50941091-50941113 CAATGAAAGGAGACCTGGCTAGG + Intronic
1174503041 20:50999628-50999650 GGAGGCAAGGAGACCAGGTCGGG + Intergenic
1175769864 20:61616846-61616868 CCCAGCACGTAGACCTGGTCAGG + Intronic
1175837197 20:62003840-62003862 CGAAGCCAGGAGCCCTGATCCGG - Exonic
1175948190 20:62568427-62568449 CAAAGCATGGAGACCAGGCGCGG - Intronic
1177205629 21:18007189-18007211 CAAATGAAGGCAACCTGGTCAGG + Intronic
1178282083 21:31292342-31292364 GAAAGCAAGGTGACCTGACCTGG - Intronic
1182252474 22:29012011-29012033 CAAAACAAAAAGGCCTGGTCTGG + Intronic
1182705112 22:32272119-32272141 TGCAGCAAGGAGACCAGGTCAGG + Intergenic
1182713059 22:32334578-32334600 CGAAGCACGGGGACTTGGTCAGG - Intergenic
1183862938 22:40682564-40682586 GAAAACAAGGAGACCTGGGGTGG + Exonic
1184208141 22:43018183-43018205 CAAAGCATGGAGAGCTGTTCCGG + Intergenic
1184664706 22:45982146-45982168 CACTTCAAGGAGACCTGGGCAGG - Intergenic
1184692122 22:46122190-46122212 CAAGGAAATGAGACCAGGTCTGG - Intergenic
1185156281 22:49195361-49195383 CAAAGCAGGGTGTCCTGGTGTGG + Intergenic
950116561 3:10454247-10454269 CAAAGCAGGAAGACCTGAACTGG + Intronic
950938090 3:16863435-16863457 CAAAGATTGGAGAGCTGGTCGGG + Intronic
953665717 3:44924974-44924996 CAAAGGAAAGAGGCCTGGTGGGG + Exonic
954361153 3:50123562-50123584 CTGAGGAAGGAAACCTGGTCTGG + Intergenic
955645640 3:61134530-61134552 CAAAGGAAGGAGAAATGATCTGG + Intronic
956463166 3:69492419-69492441 CAAATCAAAGAGACCTGCTCAGG - Intronic
962348322 3:134638628-134638650 AAAAGCAAGGAGAGCTGGCGGGG - Intronic
966295236 3:178412731-178412753 AAAAGCAAGAATACGTGGTCAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
968289369 3:197526734-197526756 CGGAGCACGGAGAGCTGGTCGGG - Intronic
971265803 4:25095459-25095481 CAAAGAATGTAGACCTGGCCGGG - Intergenic
971383577 4:26122532-26122554 CAAAGTAATGAGAACTGGTTAGG + Intergenic
971464954 4:26947601-26947623 CAAAGAATGGAGATCTGGTGAGG - Intronic
972759144 4:42084764-42084786 CAAAGGAAGGGCACCTGGCCGGG - Intronic
977492348 4:97731534-97731556 CACCGGAAGGAGACCTGGTTGGG - Intronic
978882735 4:113726699-113726721 AAAAGCAAGCAGTCGTGGTCAGG - Intronic
978887485 4:113782434-113782456 CAAAGCAAAGGTACCTGGTGAGG + Intergenic
979073656 4:116242813-116242835 CAAAACAAGCTGACCTGTTCTGG + Intergenic
981279974 4:142946131-142946153 TAACGGAAGAAGACCTGGTCAGG + Intergenic
982901796 4:161013842-161013864 AAAAGAAAGGAGACCAGGTTAGG - Intergenic
983081197 4:163387455-163387477 CAAGGCAAGGAAAGCTGGTGTGG - Intergenic
984717333 4:182938047-182938069 CAAACAACAGAGACCTGGTCAGG - Intergenic
985024591 4:185728246-185728268 GAAAGCATGGAGTCCTGGTCAGG - Intronic
986195782 5:5535507-5535529 CAAAGGAAGTAGACTTGGTTTGG - Intergenic
990376898 5:55179561-55179583 CAGAGCAAGAATATCTGGTCCGG - Intergenic
992835576 5:80637910-80637932 CAAATAAAGTAGACATGGTCTGG - Exonic
993989493 5:94638466-94638488 CAAAGCAAGGAGGCCAGGCGTGG - Intronic
995019570 5:107351934-107351956 CAAGGCAATGAGATCTGCTCCGG + Intergenic
998386946 5:141762578-141762600 CCAAGCAAGGGGACATGCTCTGG + Intergenic
999447492 5:151651794-151651816 ACAAGTCAGGAGACCTGGTCTGG - Intergenic
1001339105 5:170827336-170827358 CCAAGTAAGGAGACCTGGTAGGG + Intergenic
1001551895 5:172608820-172608842 CAAATAAAGGAGACCTGGAGAGG - Intergenic
1002601459 5:180356255-180356277 CCCAGAAAGGAGACCTGGTCTGG + Intergenic
1007821756 6:44565560-44565582 CAAAACAATGAGAGCTGGACAGG - Intergenic
1008016386 6:46525258-46525280 AAGGGCAAGGAGACCTGGTAAGG - Intergenic
1012317022 6:97793198-97793220 AAAAGCAAGAGGACCTGGTGTGG - Intergenic
1013074259 6:106756461-106756483 CAAAGGAAAGAAAACTGGTCTGG + Intergenic
1013079811 6:106802209-106802231 GAAGGAAAGGGGACCTGGTCAGG + Intergenic
1016027496 6:139301901-139301923 CAAAGCAAGGAACCCTTGACAGG + Intergenic
1016729743 6:147416409-147416431 GAAAGCATGGAGATCTGGTTCGG - Intergenic
1019950333 7:4367088-4367110 CTAAGGAAGGAGAACTGCTCGGG + Intergenic
1020031052 7:4932913-4932935 CAAAGCACGGAGACCAGGCCTGG - Intronic
1020968353 7:14901652-14901674 CAATGCAAGAGGACCTGGTTAGG + Intronic
1022215739 7:28259266-28259288 CAAAGGAAGGAGTCCTGAACAGG + Intergenic
1029309108 7:99644765-99644787 GAAAGAAAGGAGACCAGATCTGG - Intergenic
1029339727 7:99933202-99933224 CAAACCAAGGGGCCCTGGGCAGG - Intergenic
1030106746 7:105993885-105993907 CAGATCAAGGAGATCTGGGCAGG + Intronic
1030304514 7:108004393-108004415 CAAAGCTTGGAGTCCTGCTCTGG + Intergenic
1030865356 7:114695981-114696003 GAAAGCAGGGAGGCCAGGTCAGG - Intergenic
1031588703 7:123564166-123564188 CAAAGTAGGGAGACCTGTTTTGG - Intergenic
1032799997 7:135310263-135310285 CTAAGGAAGGAGAACTGGCCTGG + Intergenic
1033089752 7:138374442-138374464 AAAAGAAGGGAGCCCTGGTCTGG - Intergenic
1034780882 7:153881549-153881571 CAAAGCAGGGAGACAGGGACAGG - Intergenic
1036533461 8:9620240-9620262 CAAAGAAAGGAGTCCCGGCCGGG - Intronic
1040638416 8:49302867-49302889 CAGAGAAAGGAGACATGGCCTGG + Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1044843927 8:96361552-96361574 AAAACCAAGGAGACCTGCTGTGG + Intergenic
1046482929 8:114846840-114846862 CAACCCAAGGAGACATGGCCAGG + Intergenic
1049038764 8:140097174-140097196 CAAAGCAAAGACACCTGCCCTGG + Intronic
1053519435 9:38763200-38763222 CCAAGCAAGGAGAATTGGGCAGG - Intergenic
1053537427 9:38939232-38939254 CAAGGCAAGGATACCAGGTGGGG - Intergenic
1054337134 9:63817337-63817359 CACAGAAAGGAGAACTGGCCTGG + Intergenic
1054628708 9:67424698-67424720 CAAGGCAAGGATACCAGGTGGGG + Intergenic
1055972439 9:81925062-81925084 AAATGAAAGGAGACCTGGCCTGG + Intergenic
1055974192 9:81940134-81940156 AAATGAAAGGAGACCTGGCCTGG + Intergenic
1058460353 9:105176791-105176813 CAAAGTTAGGAGACCTGGTGGGG - Intergenic
1061538530 9:131264666-131264688 CAAATCAGGGCTACCTGGTCTGG - Intronic
1062701061 9:137903520-137903542 AAAAGCAAGGAGAACGGGACTGG - Intronic
1185493248 X:535567-535589 CAAAGCAAGCAGATCTCTTCAGG - Intergenic
1185769204 X:2752269-2752291 CAAACCATGGAGAGCTGGTGGGG + Exonic
1190228092 X:48561002-48561024 CAAAGAATGGAGATCTGGTGGGG - Exonic
1191834816 X:65453428-65453450 CAAAGGAACGAGACCAGGTGCGG + Intronic
1192632086 X:72785051-72785073 CAAAGAAAGGAGTCCCGGGCTGG + Intronic
1192649623 X:72935750-72935772 CAAAGAAAGGAGTCCCGGGCTGG - Intronic
1194374876 X:93119981-93120003 CAAAGGAAGTAGATCTGGGCAGG + Intergenic
1195970324 X:110465930-110465952 CAAAGCAAGAAGATCTGCTGAGG - Intergenic
1197272470 X:124440158-124440180 CAGAGCCAGGAGACTAGGTCTGG + Intronic
1197725622 X:129774446-129774468 GAAAGCAAGGAGACAAGGGCAGG - Intergenic
1197937255 X:131752749-131752771 GAAAGCAAGAAGACCTAGCCTGG - Intergenic
1198299474 X:135321053-135321075 CAAGGCACTGACACCTGGTCTGG + Intronic
1199690723 X:150307102-150307124 CAAAGCAATCAGTCCTGCTCAGG - Intergenic
1199990776 X:152986551-152986573 CAGAGCAAGGAGACTTTGTCGGG - Intergenic
1200033865 X:153316025-153316047 CAGAGCAAGGAGACTTTGTCGGG - Intergenic
1201301302 Y:12507353-12507375 CAAACCATGGAGAGCTGGTGGGG - Intergenic
1201433981 Y:13936887-13936909 CAAATCAAGGAGATATGGGCAGG - Intergenic
1201639890 Y:16167393-16167415 CCAAGGAAGGACACCTGGTATGG - Intergenic
1201662923 Y:16417932-16417954 CCAAGGAAGGACACCTGGTATGG + Intergenic