ID: 1084329670

View in Genome Browser
Species Human (GRCh38)
Location 11:68423110-68423132
Sequence CTAGACTGGCGCTCCCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 62}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084329670_1084329672 -9 Left 1084329670 11:68423110-68423132 CCTTCATGGGAGCGCCAGTCTAG 0: 1
1: 0
2: 0
3: 9
4: 62
Right 1084329672 11:68423124-68423146 CCAGTCTAGTGATGCACAGCTGG 0: 1
1: 0
2: 0
3: 7
4: 104
1084329670_1084329676 3 Left 1084329670 11:68423110-68423132 CCTTCATGGGAGCGCCAGTCTAG 0: 1
1: 0
2: 0
3: 9
4: 62
Right 1084329676 11:68423136-68423158 TGCACAGCTGGGTGCCCGGCGGG 0: 1
1: 0
2: 2
3: 18
4: 198
1084329670_1084329675 2 Left 1084329670 11:68423110-68423132 CCTTCATGGGAGCGCCAGTCTAG 0: 1
1: 0
2: 0
3: 9
4: 62
Right 1084329675 11:68423135-68423157 ATGCACAGCTGGGTGCCCGGCGG 0: 1
1: 0
2: 2
3: 6
4: 175
1084329670_1084329677 6 Left 1084329670 11:68423110-68423132 CCTTCATGGGAGCGCCAGTCTAG 0: 1
1: 0
2: 0
3: 9
4: 62
Right 1084329677 11:68423139-68423161 ACAGCTGGGTGCCCGGCGGGTGG 0: 1
1: 0
2: 1
3: 18
4: 179
1084329670_1084329674 -1 Left 1084329670 11:68423110-68423132 CCTTCATGGGAGCGCCAGTCTAG 0: 1
1: 0
2: 0
3: 9
4: 62
Right 1084329674 11:68423132-68423154 GTGATGCACAGCTGGGTGCCCGG 0: 1
1: 0
2: 0
3: 16
4: 274
1084329670_1084329679 15 Left 1084329670 11:68423110-68423132 CCTTCATGGGAGCGCCAGTCTAG 0: 1
1: 0
2: 0
3: 9
4: 62
Right 1084329679 11:68423148-68423170 TGCCCGGCGGGTGGCTGAGGAGG 0: 1
1: 0
2: 3
3: 22
4: 391
1084329670_1084329673 -8 Left 1084329670 11:68423110-68423132 CCTTCATGGGAGCGCCAGTCTAG 0: 1
1: 0
2: 0
3: 9
4: 62
Right 1084329673 11:68423125-68423147 CAGTCTAGTGATGCACAGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 107
1084329670_1084329678 12 Left 1084329670 11:68423110-68423132 CCTTCATGGGAGCGCCAGTCTAG 0: 1
1: 0
2: 0
3: 9
4: 62
Right 1084329678 11:68423145-68423167 GGGTGCCCGGCGGGTGGCTGAGG 0: 1
1: 0
2: 4
3: 40
4: 328
1084329670_1084329682 29 Left 1084329670 11:68423110-68423132 CCTTCATGGGAGCGCCAGTCTAG 0: 1
1: 0
2: 0
3: 9
4: 62
Right 1084329682 11:68423162-68423184 CTGAGGAGGCCTAAAGTCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084329670 Original CRISPR CTAGACTGGCGCTCCCATGA AGG (reversed) Intronic
902531193 1:17091792-17091814 CTAGACTGGCGGCTCCTTGAGGG + Intronic
915131515 1:153698333-153698355 CTAGACTGCCCCTCCCATGTGGG - Intergenic
1063918289 10:10906434-10906456 CTAGACTGTAGATTCCATGAGGG - Intergenic
1067088718 10:43255884-43255906 CTAGACTGGTGCTCCTCTGGGGG - Intronic
1071524068 10:86348003-86348025 CTAGACAGGCTCCCCCAGGAAGG + Intronic
1071811680 10:89188893-89188915 TGAGAGTGGGGCTCCCATGATGG + Intergenic
1073402734 10:103272239-103272261 CTAGAATGCCACTCCCATGGAGG + Intergenic
1084329670 11:68423110-68423132 CTAGACTGGCGCTCCCATGAAGG - Intronic
1088699135 11:112396509-112396531 CTAGATTGGAAATCCCATGAGGG + Intergenic
1092780645 12:11983434-11983456 CTAGACTGCAGCTGCCATCAGGG + Intergenic
1096614085 12:52821932-52821954 AGAGACTGGCCCTCCCTTGACGG + Exonic
1102377112 12:112431429-112431451 CTAGACTGGCAGTTCCATGAGGG - Intronic
1102478261 12:113202680-113202702 CTAGACTGGGGGCCACATGATGG + Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1105302655 13:19150233-19150255 CTAGACTGGGGCTTCCCTGGGGG - Intergenic
1105635731 13:22213446-22213468 CTAGGCTGGGGATCCCATGCAGG - Intergenic
1106150967 13:27101550-27101572 CTAGACTGTCAGTTCCATGACGG - Intronic
1110578724 13:77092980-77093002 CTAGTCTGCCTCTCCCATCAAGG + Intronic
1113216214 13:108043525-108043547 CAAGACTGGCCATCTCATGAGGG + Intergenic
1113265266 13:108609382-108609404 CTAGACTGTGAATCCCATGAGGG + Intronic
1113711856 13:112470323-112470345 CTAGTCTGGCTCTCCCAAGAAGG - Intergenic
1128105603 15:65042492-65042514 CTAGACTGGAGTCTCCATGAGGG + Intergenic
1132457969 16:34792-34814 CTGGACTGCTGCTCCCAGGAGGG + Intergenic
1133369080 16:5234424-5234446 CTACACAGGCGCCCCCATAAGGG - Intergenic
1136110645 16:28062423-28062445 CTAGCCTGCCTCTCCCAGGAGGG + Intronic
1138136102 16:54524062-54524084 CTAGAATGGAGATCTCATGAGGG + Intergenic
1138372939 16:56541760-56541782 CTAGACTGGCGTTCCCAAAAGGG - Intergenic
1141096212 16:81164948-81164970 CTAGACTGGAGGCTCCATGAGGG + Intergenic
1142123644 16:88399539-88399561 CCAGCCTGGCCCTCCCATGAAGG - Intergenic
1143068516 17:4268952-4268974 CTAAACTGGCTCTACCATAAAGG - Intergenic
1147701845 17:42401174-42401196 CCAGGGTGGGGCTCCCATGATGG - Intergenic
1150724102 17:67637589-67637611 CAAGACTGCCTCTCTCATGAAGG + Intronic
1159270156 18:66138518-66138540 CTAGATGGACGTTCCCATGACGG + Intergenic
1159488555 18:69099077-69099099 TCAGAGTGGAGCTCCCATGATGG + Intergenic
1161267708 19:3372503-3372525 CTAGACTGTCGGTCCCACAAGGG - Intronic
1162029228 19:7910181-7910203 CCCCACTGGCGCTCCCAGGATGG - Intronic
1165786232 19:38463561-38463583 CTAGACTTGCGGTGCCAGGAGGG + Intronic
925169230 2:1740716-1740738 CTGGACTGGGGATTCCATGAGGG + Intronic
942256555 2:174107110-174107132 CTAAACTGGAGCTCCCAACAAGG - Intronic
1170740696 20:19053504-19053526 GTTGACTGGAGCTGCCATGAGGG + Intergenic
1181095778 22:20504298-20504320 CCAGACTGGGGATCCCAGGAGGG + Intronic
1182066963 22:27437862-27437884 CTAGACTGGAGCCCACAGGAGGG + Intergenic
1182596670 22:31426507-31426529 CCCAACTGGCGCTCCCAAGAGGG - Intronic
951270706 3:20619945-20619967 CTGGATTCGAGCTCCCATGATGG + Intergenic
961696996 3:128712261-128712283 CTAGACTGTAAGTCCCATGAAGG + Intergenic
970069486 4:12140996-12141018 CTAGACTGGAGGTCCCTTCAAGG + Intergenic
972770501 4:42192888-42192910 CTAGACTGGCAGCCCCATGAAGG + Intergenic
973848221 4:54934810-54934832 CTAGACTGCCTCACCCATGGTGG - Intergenic
978194497 4:105954911-105954933 CTAGAATGTAGATCCCATGAAGG + Intronic
996611691 5:125388944-125388966 CAAGACTGACGGTGCCATGAGGG + Intergenic
998221978 5:140290302-140290324 CTGGAAAGGTGCTCCCATGAAGG + Intronic
999450017 5:151670956-151670978 CTAGACTGCCACTAGCATGATGG + Intronic
999693870 5:154171290-154171312 CTAGACTGGAACCCCCATGAGGG - Intronic
999820201 5:155219718-155219740 CTAGACTGTAACTTCCATGAAGG - Intergenic
1005125358 6:22440986-22441008 CTAGACTGTCTACCCCATGAGGG - Intergenic
1005957699 6:30676175-30676197 CTAGACTGGAAGTGCCATGAGGG - Intergenic
1007359490 6:41344931-41344953 CTAGACTTACACTCCCAGGAAGG - Intronic
1012863100 6:104585248-104585270 CAAGACTGTCTCTGCCATGAGGG + Intergenic
1017717849 6:157224623-157224645 CAAGGCTGCCGCTCCCCTGAGGG - Intergenic
1017739812 6:157397156-157397178 CTTGACTGGGGCTCCCATTCAGG - Intronic
1031147795 7:118016493-118016515 CTAGATTGCAGCTCCCATGCAGG + Intergenic
1031226193 7:119041333-119041355 CTAGACTGCCCCTCCCATTATGG + Intergenic
1031256095 7:119450548-119450570 CTAGACTGGCCCTGTCCTGAGGG + Intergenic
1031938565 7:127762451-127762473 CTAATCTGGTGCTCCCATAAGGG - Intronic
1039826371 8:41177421-41177443 CTAGACTGGAACTTCCTTGAGGG + Intergenic
1046667854 8:117024556-117024578 CTAGACTGTAACTGCCATGAGGG + Intronic
1047710482 8:127546839-127546861 CTAGACAGCAGCTCCCTTGAGGG - Intergenic
1050801449 9:9620282-9620304 CTAGACTGTAAGTCCCATGAAGG + Intronic
1186632588 X:11366049-11366071 TGAGAGTGGGGCTCCCATGATGG - Intronic
1187568591 X:20477678-20477700 CTAGACTGGAAGTTCCATGAAGG + Intergenic
1192586727 X:72325057-72325079 CTAGACTGGGGCAACCATGAAGG - Intergenic
1194747489 X:97644435-97644457 GTAGACTGGCACTACCATTATGG - Intergenic