ID: 1084330003

View in Genome Browser
Species Human (GRCh38)
Location 11:68424651-68424673
Sequence AGGGCTGAAGCCCGAGATCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084329999_1084330003 22 Left 1084329999 11:68424606-68424628 CCAGGTGGCTGAGAGTAATGGAC 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1084330003 11:68424651-68424673 AGGGCTGAAGCCCGAGATCGAGG 0: 1
1: 0
2: 1
3: 17
4: 223
1084329997_1084330003 29 Left 1084329997 11:68424599-68424621 CCAGAAGCCAGGTGGCTGAGAGT 0: 1
1: 0
2: 2
3: 22
4: 421
Right 1084330003 11:68424651-68424673 AGGGCTGAAGCCCGAGATCGAGG 0: 1
1: 0
2: 1
3: 17
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084330003 Original CRISPR AGGGCTGAAGCCCGAGATCG AGG Intronic
900144344 1:1151388-1151410 GGGCCTGGAGCCCGAGATCTGGG - Intergenic
900623476 1:3597771-3597793 AGGCCGGAAGTCCGAGATCAAGG - Intronic
900626778 1:3611938-3611960 AGGGCTGTCTCCTGAGATCGAGG - Intergenic
900839626 1:5037784-5037806 AGGCCAGAAGTCCAAGATCGAGG - Intergenic
902087708 1:13875932-13875954 AGAGATGAAGACCGAGATAGGGG - Intergenic
903013065 1:20343938-20343960 GGGGCTGAAGCCAGAGATGAAGG - Intronic
903630852 1:24769040-24769062 GGGGCTGAAGCAGGAGATTGAGG + Intronic
904971333 1:34421557-34421579 AGGCCAGAAGTCTGAGATCGCGG - Intergenic
906326240 1:44847849-44847871 AGGGCTGCAGCCAGAGATTAGGG + Intergenic
906400429 1:45500350-45500372 AGAGCTGAAGCAGAAGATCGAGG + Exonic
907973400 1:59407177-59407199 AGGGCTAAAGCTCGAGACCCAGG - Intronic
909823303 1:80093292-80093314 AGAGCTGAAGCAGGAGATCTTGG - Intergenic
910885009 1:91954875-91954897 ATGGCTTGAGCCCGAGATCGAGG + Intronic
912673019 1:111648967-111648989 GCAGCTGAAGCCAGAGATCGAGG - Intronic
912958342 1:114172404-114172426 AGGGCTGAAGCCAAAAATCTGGG + Intergenic
913536228 1:119775312-119775334 AGGGCTGGAGCCTGAGGTGGAGG + Intergenic
916496820 1:165354814-165354836 AGAGCTGAAGCCAGAGATTCTGG - Intronic
918448689 1:184639085-184639107 AGGGCAGAAGTCCAAGATCAAGG - Intergenic
921738259 1:218653448-218653470 GGGGCTGAAGCCAGGGAGCGAGG + Intergenic
923183786 1:231549912-231549934 AGGCCTCAAGTCTGAGATCGAGG + Intronic
923221878 1:231902689-231902711 AGGGCAGAAGTCTGAAATCGAGG + Intronic
924208187 1:241736204-241736226 TGGGCTGAAGCCTGAGACCTGGG - Intronic
1063817109 10:9788094-9788116 AAGGCTGAAGTCCTAGATCAAGG + Intergenic
1064891725 10:20182784-20182806 AGGGCTTAAACCCTAGATGGTGG - Intronic
1065349446 10:24782521-24782543 GAGGCTGAAGCCAGATATCGTGG + Intergenic
1065811972 10:29450763-29450785 AGGGCGGAAGTCTGAGATCAAGG + Intergenic
1065959809 10:30725394-30725416 AGGGCGGAAGTCTGAGATCAAGG - Intergenic
1067810004 10:49418739-49418761 AGGGCAGAAGCCCGGGCTTGTGG - Intergenic
1073447529 10:103590400-103590422 TGGGCTGAAGCCCGAGAAGATGG - Exonic
1075708297 10:124516159-124516181 AGGCTTGAAGCCTGAGATCAGGG + Intronic
1076377628 10:130002323-130002345 TGGGCTGGAGCCCCAGATTGAGG - Intergenic
1077262301 11:1629325-1629347 AGGGCTGAAGCCCCAGGTCCTGG + Intergenic
1077878201 11:6325281-6325303 AGGGCAGAAGCCTGAAATCAAGG - Intergenic
1078107214 11:8365860-8365882 GGTGCTGAAGCCCGAGTTCCAGG - Intergenic
1078836661 11:15036669-15036691 AGGGCTGGAGACAGAGATCCTGG + Intronic
1082902875 11:58275220-58275242 AGGCTTGAAGTCCGAGATCAAGG + Intergenic
1083690158 11:64403058-64403080 AGGCCAGAAGCCCAAGATCAAGG - Intergenic
1083876516 11:65526835-65526857 AGGGCTGCTGCCCGAGGTAGGGG - Exonic
1083912544 11:65718705-65718727 GGGGCTGAAGTCGGAGAGCGGGG + Exonic
1084028551 11:66467391-66467413 TGTGCTGCAGCCCGAGCTCGAGG + Intronic
1084330003 11:68424651-68424673 AGGGCTGAAGCCCGAGATCGAGG + Intronic
1085321374 11:75576170-75576192 AGGGCTGAAGTGGGAGATGGAGG + Intergenic
1087154033 11:94883841-94883863 GGGGCTGAAGCTAGAGAGCGAGG + Intergenic
1089014336 11:115154220-115154242 AGGGCTGAGGCACCAGAACGGGG - Intergenic
1094069921 12:26401890-26401912 AGGGCTGAAGTCAGAGATGAAGG + Intronic
1096558227 12:52417396-52417418 AGAGCTGAAGCCCCAGGTCCTGG + Intergenic
1096849299 12:54425502-54425524 AGGACTGAGGCCAGAGGTCGGGG - Intergenic
1098435807 12:70467421-70467443 AGGCCAGAAGCCTGAGATCAAGG + Intergenic
1099774377 12:87105308-87105330 AAGGCTGAAGCTGGAGATCAGGG + Intergenic
1099918755 12:88930732-88930754 AGGGCTGAAGCATGAGTTCTGGG + Intergenic
1101495935 12:105254135-105254157 GGGGCTGAAGCCAGAAATCTGGG + Intronic
1101568215 12:105929593-105929615 AGGCCAGAAGTCTGAGATCGAGG - Intergenic
1102108971 12:110349594-110349616 AGGGCTGAAGCTCCAGTCCGAGG - Intronic
1103716041 12:122945940-122945962 AGGACTGATGTCCTAGATCGAGG + Intronic
1104019904 12:124985121-124985143 AGGCCAGAAGTCCGAGATCAAGG - Intronic
1106476156 13:30099948-30099970 AGGCCAGAAGCCCAAGATCAAGG + Intergenic
1106702708 13:32246867-32246889 AGGGCTGAAGACAGAGATCAAGG + Intronic
1107917746 13:45169419-45169441 GGGGCTGAAGTCCAAGATCGAGG - Intronic
1110117632 13:71839654-71839676 AGGGCAGAAGCCCTAGATTTTGG - Intronic
1110921453 13:81091849-81091871 ATGGCTGAAGCCTGAGACTGAGG - Intergenic
1111574035 13:90127061-90127083 AGGGAAGAAGCCTGAGATCAAGG + Intergenic
1112601441 13:100859402-100859424 AGGCCTGAAGTCCAAGATCCAGG + Intergenic
1112687781 13:101851388-101851410 AGGTCAGAAGCCCGAGATCGAGG - Intronic
1113374239 13:109749460-109749482 TGGCCTGAAGCCTGAGATCCTGG - Intergenic
1114195755 14:20474841-20474863 AGGGCTGAACCCCAAGTTTGAGG + Exonic
1116103695 14:40473684-40473706 AGGCCTGAAGTCTGAGATCAAGG + Intergenic
1117627395 14:57653865-57653887 AGGCCAGAAGCCCAAGATCAAGG + Intronic
1119539045 14:75427296-75427318 AGGGCTGCAGCCTGAGACCGCGG - Intergenic
1119545588 14:75469319-75469341 AGAGCTGAAGACCCAGATTGAGG + Exonic
1120865650 14:89293393-89293415 AGGGCAGAAGTCCAAGATCAAGG + Intronic
1121529018 14:94639732-94639754 AAGGCTGAAGCCCTAGAAGGAGG + Intergenic
1121754805 14:96393440-96393462 AGGGCAGAAGTCCAAGATCAAGG + Intronic
1122135548 14:99630761-99630783 AGGTTGGAAGTCCGAGATCGAGG + Intergenic
1122409730 14:101519738-101519760 AGGGCTGAAGGCAGAGGTTGGGG - Intergenic
1122842110 14:104471043-104471065 AGGGCTTGAGCCTGAGATCCTGG + Intergenic
1122918514 14:104869809-104869831 AGGCTGGAAGCCCGAGATCTAGG - Intronic
1123013849 14:105364257-105364279 AGGGCTGCAGCCCGGGTGCGCGG + Intronic
1123981826 15:25611949-25611971 AGTGCTGAAGCCCCAGCCCGAGG + Intergenic
1124193658 15:27601431-27601453 AAGGCTGAAGCCCAAGCTGGAGG + Intergenic
1124861494 15:33446452-33446474 AGGCTGGAAGCCCGAGATCAAGG + Intronic
1128839317 15:70836888-70836910 AGGCCTGAAGCCCGAAATCAAGG - Intronic
1130255676 15:82325069-82325091 AAGGCTGAAGCCCCAGACCCCGG + Intergenic
1130546246 15:84859070-84859092 AGGGCAGAAGCCTGAGATATAGG + Intronic
1130793783 15:87187022-87187044 AGGTCAGAAGTCCAAGATCGAGG - Intergenic
1135084868 16:19467270-19467292 AGGCCTGAAGTCCAAGATCAAGG + Intronic
1135240831 16:20806222-20806244 AAGGCTGAAGACCGAGGTCCAGG + Intronic
1135405054 16:22191346-22191368 AGGGGTGAAGCCAGAGAGGGAGG - Exonic
1135778049 16:25274484-25274506 AGGCTAGAAGCCTGAGATCGAGG + Intergenic
1136646530 16:31624047-31624069 CCGGCTGAAGCCCAAGATCAAGG + Intergenic
1137949011 16:52764351-52764373 AGGGCTCAAGCCTGAGGTCAGGG - Intergenic
1138395090 16:56697946-56697968 AGGCCAGAAGTCCGAGATCAGGG + Intronic
1139214214 16:65111631-65111653 AGGACTGAAGCCAGAAATCTAGG - Intronic
1140233047 16:73133646-73133668 AGGCCAGAAGCCCAAGATCAAGG - Intronic
1141528409 16:84628613-84628635 GAGGCTGAAGCCCCAGGTCGTGG - Intergenic
1141672648 16:85500782-85500804 AGGCCCGAAGTCCCAGATCGAGG + Intergenic
1141740052 16:85885120-85885142 AAGGCTGAATCCAGAGATGGGGG - Intergenic
1142699266 17:1649515-1649537 AGGGCCGAAGCCTGAGACCCGGG - Intronic
1144152343 17:12461589-12461611 AGGACAGAAGTCCAAGATCGAGG - Intergenic
1144304718 17:13957844-13957866 AGGGGTGAAGGCCAAGATCCTGG + Intergenic
1144519384 17:15944318-15944340 AGGGCTGAAGCAAGAGATTTGGG + Intergenic
1146529585 17:33596958-33596980 AAGGCTGAAGCCAGAAATCCTGG - Intronic
1147888195 17:43698617-43698639 AGGGTTGAAGGCCGAGAGCCAGG + Intergenic
1151575023 17:74948878-74948900 AGGAGTGAAGCCCGAGCTCAGGG + Intronic
1152335007 17:79695724-79695746 AGGGCAGAAGCCTGAGGTCAAGG - Intergenic
1152432658 17:80258013-80258035 AGGCCGGAAGCCCAAGATCAGGG - Intergenic
1152704827 17:81837787-81837809 GGAGATGAAGGCCGAGATCGTGG - Intergenic
1153341907 18:3984171-3984193 GAGGCTGAAGTCCGAGATCAAGG - Intronic
1154246401 18:12703024-12703046 AAGGCGGAAGCCCGAGACCCCGG - Exonic
1154336172 18:13466742-13466764 AGGTCGGAAGTCTGAGATCGGGG + Intronic
1157974436 18:52310756-52310778 AGGTCAGAAGTCCGAAATCGAGG + Intergenic
1160823981 19:1071049-1071071 AGACCTGAAGCCCGGGAACGAGG - Intronic
1161219575 19:3112295-3112317 AGGGCTGAAGTCGGAGTCCGGGG + Intronic
1161732454 19:5969710-5969732 GGGGCTGAAGCCCGAGGCCATGG - Intronic
1162784861 19:13028341-13028363 AGGGCTGAAGAGCCAGATCTGGG + Intronic
1163668263 19:18613102-18613124 AGGGCTGCGGGCCGAGGTCGCGG - Exonic
1164507903 19:28874522-28874544 AAAGCTGAAGCCCGAGACCTAGG + Intergenic
1165343541 19:35228736-35228758 AGGGCTGAGGCCAGAGTTCATGG - Intergenic
1167375407 19:49108294-49108316 AGGGATGAGGCCCGAGGTGGGGG + Exonic
1167562381 19:50233607-50233629 AGGCCAGACGCCCGGGATCGTGG + Intronic
1168078499 19:53992964-53992986 GGGGCTGACGCCCGAGCGCGAGG + Exonic
925683187 2:6444723-6444745 AGGCCAGAAGTCCGAGATCAAGG + Intergenic
927056447 2:19369760-19369782 AGGGCTGAGGCCCATGATCCTGG - Intergenic
928431567 2:31223062-31223084 AGGTTGGAAGCCCGAGATCACGG - Intronic
935326965 2:101946251-101946273 AGGGTGGAAGCCCAAGATCAAGG - Intergenic
938970997 2:136432284-136432306 AGGGTTGAAGTCCAAGATCAAGG + Intergenic
940521239 2:154751740-154751762 AGGCTTGAAGCCCAAGATCAAGG + Intronic
940602587 2:155880380-155880402 AGGGCTGAAGCCAGGGAGCCAGG + Intergenic
946885073 2:224215131-224215153 GAGGCTGAAGCCCAAGATCAAGG + Intergenic
948126249 2:235566852-235566874 AGGCCTGAAGCCCAGGATCAAGG + Intronic
948652651 2:239458109-239458131 AGGCCAGAAGACTGAGATCGAGG + Intergenic
948940364 2:241192392-241192414 GGGGCTGAAGCCCGAGGTGAGGG + Intronic
1170665255 20:18381107-18381129 ACAGCTGAAGGCAGAGATCGGGG - Intergenic
1171208789 20:23301373-23301395 GGGGCCGAAGTCCGAGATCCAGG - Intergenic
1171534041 20:25870497-25870519 AGGGCAGAAGTCCAAGATCAAGG + Intergenic
1173418587 20:42880488-42880510 AGGGCTGAAGCCAGAGGTAGTGG - Intronic
1175740814 20:61418722-61418744 AGGCCGGAAGCCTGAGATGGAGG + Intronic
1175976497 20:62712878-62712900 AGGGCTGATGGCCCAGATGGTGG + Intronic
1176155360 20:63617407-63617429 AAGGCTGAAGTCCAAGATCAGGG - Intronic
1178334410 21:31731420-31731442 AGGGGAGAAGCCCGAGGTCGCGG + Intronic
1178427665 21:32491915-32491937 AGCGCTGAAGGCAGAGATCCTGG + Intronic
1179628972 21:42665247-42665269 AGGCCTGAAGCCTGAGCTCGAGG - Intronic
1179642449 21:42756559-42756581 AGGGCTGTGGCCCGTGAGCGTGG + Intronic
1179642463 21:42756606-42756628 AGGGCTGTGGCCCGTGAGCGTGG + Intronic
1180181625 21:46120821-46120843 AGGGCTGCAACCCAAGATAGGGG + Intronic
1182079548 22:27519167-27519189 AGGACTGCAGCCCCAGATAGGGG - Intergenic
1183300155 22:37054977-37054999 AGGCTAGAAACCCGAGATCGGGG + Intronic
954463117 3:50638881-50638903 AGGGCTGATGCTCAAGACCGGGG - Intronic
954683583 3:52358817-52358839 AGGGCTGCAGCCTGAGGACGAGG - Intronic
955717661 3:61847405-61847427 AGGGCAGAAGTCCAAGATCAAGG - Intronic
959091835 3:101911423-101911445 GGGGCTGAAGCCAGAGAGCCAGG - Intergenic
961393093 3:126568272-126568294 AGGGCTGCAGTCCCAGAGCGGGG - Intergenic
962827664 3:139111754-139111776 AGGGCTGAAGGCAGAGAGCAGGG + Intronic
968489852 4:884145-884167 AGGGCTTAAGCCAGAGCCCGAGG + Intronic
968984337 4:3867022-3867044 AGGCCAGAAGCCCGAGATCCAGG + Intergenic
969050493 4:4369591-4369613 AAGCCTGAAGCCCCAGATCAAGG + Intronic
969220857 4:5757521-5757543 GAGGCTGAAGCCCGAGATCACGG + Intronic
969463135 4:7339411-7339433 AGGCCGGAAGCCTGAGATCGAGG + Intronic
969704794 4:8785851-8785873 AGGCCAGAAGCCTGAGATCCAGG - Intergenic
969839478 4:9870165-9870187 AGGCCAGAAGGCAGAGATCGAGG - Intronic
971069081 4:23070215-23070237 AGGGTAGAAGCCTGAGATCAAGG - Intergenic
973728170 4:53796556-53796578 AGGCCAGAAGCCTGAGATCAAGG - Intronic
974123247 4:57664964-57664986 AGGCCAGAAGCCCAAGATCAAGG - Intergenic
977576603 4:98681543-98681565 AGGGCAGAAGTCGGAGATCAAGG - Intergenic
978514959 4:109560047-109560069 AGAGCGGGAGCCCGAGGTCGAGG - Intergenic
980063402 4:128155823-128155845 AGGGCTGCAGCGAGAGATCGAGG + Intronic
982013917 4:151133431-151133453 AAGGCTGAAGCTCAAGGTCGCGG + Intronic
983953275 4:173667381-173667403 AGGCTTGAAGCCCAAGATCAAGG - Intergenic
985581095 5:695554-695576 AGGCCAGAAGTCCGAGATCAAGG + Intergenic
985595719 5:786886-786908 AGGCCAGAAGTCCGAGATCAAGG + Intergenic
985664754 5:1176325-1176347 AGGCTGGAGGCCCGAGATCGAGG - Intergenic
986669251 5:10128176-10128198 GAGGCTGAAGTCCGAGATCAAGG - Intergenic
994956566 5:106540716-106540738 AGGGCAGAAGCCTTAGATCAGGG - Intergenic
1000566949 5:162860128-162860150 AGGCCAGAAGTCCGAGATCAGGG - Intergenic
1001545013 5:172565648-172565670 AGGCCAGAAGTCCGGGATCGGGG + Intergenic
1002540411 5:179902833-179902855 GGCTCTGAAGCCAGAGATCGGGG + Intronic
1004310334 6:14539921-14539943 GAGGCTGAAGCCCGAGATCCAGG - Intergenic
1004715801 6:18215370-18215392 AGGCTGGAAGCCTGAGATCGAGG + Intronic
1005639828 6:27785360-27785382 TGGGCTGCAGCCCGAGAGGGTGG + Intergenic
1006107740 6:31726973-31726995 AGGGCTGAAACCTGAGTTTGGGG - Intergenic
1007311072 6:40946447-40946469 AGGCCAGAAGCCTGAGATCAAGG + Intergenic
1007449594 6:41932791-41932813 ATGGCTGAAGACCCAGATCAGGG + Exonic
1008504569 6:52217079-52217101 AGAGCTGAAGCCACAGATCTCGG - Intergenic
1009510820 6:64548001-64548023 AGGGCTGCAGCACGAGTTCTGGG - Intronic
1013412812 6:109897116-109897138 AGGCTTGAAGCCTGAGATCAGGG + Intergenic
1013439544 6:110148915-110148937 AGGGGTGAAGCCCAAGTTCTTGG + Intronic
1015517052 6:134093133-134093155 AGGCTGGAAGCCCGAGATCAAGG - Intergenic
1017636824 6:156452104-156452126 AGGGCTGAAACCCAAGAAAGTGG - Intergenic
1018038392 6:159900994-159901016 AGGCCAGAAGTCCAAGATCGAGG + Intergenic
1018089152 6:160330447-160330469 AGGACGGAAGCCCAAGATCAAGG - Intergenic
1018750578 6:166800635-166800657 AGGCCGGAAGTCCAAGATCGAGG - Intronic
1018871779 6:167789654-167789676 AGGCCGGAAGTCCGAGATCCAGG - Intronic
1018909284 6:168092667-168092689 AGGCTTGAAGCCTGAGATCAAGG - Intergenic
1019378114 7:706917-706939 AGGGCAGAAGCCCCTGATGGAGG - Intronic
1019378355 7:708199-708221 AGGCTGGAAGTCCGAGATCGAGG - Intronic
1020058524 7:5135271-5135293 AGGGCTGAAGGCAGAGAAGGTGG + Intergenic
1020214688 7:6180562-6180584 AGGCCAGAAGTCCGAGATCGGGG - Intronic
1021562681 7:21984860-21984882 AGGCTTGAAGCCCAAGATCATGG + Intergenic
1021956912 7:25834352-25834374 AGGCTTGAAGTCCGAGATTGAGG - Intergenic
1022198810 7:28095820-28095842 AGGGCAGAAGTCCCAGATCAAGG + Intronic
1022484844 7:30770564-30770586 AGGGCTACAGACCAAGATCGAGG - Intronic
1024650144 7:51396827-51396849 ATGGCTTGAGCCCGAGGTCGAGG - Intergenic
1024718442 7:52107102-52107124 AGGTTTGAAGTCCAAGATCGAGG - Intergenic
1025054292 7:55752476-55752498 ATGGCTTGAGCCCGAGGTCGAGG - Intergenic
1025990601 7:66493970-66493992 AGGGCTGTAGCCGGAGCTAGCGG - Intergenic
1026735529 7:72946339-72946361 GCGGCTGAAGCCAGAGATCCGGG - Intronic
1026785867 7:73301269-73301291 GCGGCTGAAGCCAGAGATCCGGG - Intergenic
1027108197 7:75418669-75418691 GCGGCTGAAGCCAGAGATCCGGG + Exonic
1027213258 7:76166962-76166984 AGGGCTGTAGCCGGAGCTAGCGG - Intergenic
1027827006 7:83128192-83128214 AGGGATAAAGCCCAAGACCGGGG + Intronic
1034555771 7:151849575-151849597 AGGCCTGAAGTCCAAGATCAAGG + Intronic
1034825938 7:154262523-154262545 AGGCCGAAAGCCCGAGATCAAGG - Intronic
1034861362 7:154597716-154597738 AGGCCAGAAGTCAGAGATCGAGG + Intronic
1035915839 8:3621139-3621161 AGGGTAGAAGCCTGAGATCAAGG - Intronic
1036009766 8:4708975-4708997 AGGTTGGAAGCCCAAGATCGAGG - Intronic
1036092676 8:5685181-5685203 AGGGTAGAAGCCTGAGATCAAGG + Intergenic
1036167731 8:6452784-6452806 TGGCCTGAAGGCCGAGATCACGG - Intronic
1040980906 8:53245413-53245435 AGGCCAGAAGCCTGAGATCAAGG - Intronic
1041391810 8:57353632-57353654 AGGCCAGAAGCCTGAGATCACGG + Intergenic
1043523941 8:81075759-81075781 ACAGCTGAAGCCCAAGAGCGTGG + Intronic
1044884275 8:96760033-96760055 AGGGCTGAGGCCTGAAATCAGGG - Intronic
1046552475 8:115734069-115734091 AGGGATGAAGACCGAGAGCCCGG - Intronic
1049244797 8:141556580-141556602 GAGGCTGAAGCCTGAGATCCAGG + Intergenic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049874432 8:145007213-145007235 GAGGCTGAAGCCCAAGATCAGGG + Intergenic
1051066061 9:13104484-13104506 AGGGCAGAAGCCTGAAATCAAGG + Intergenic
1053071901 9:35106724-35106746 AGGGCAGAAGCCCTACATAGTGG - Intronic
1056684254 9:88746628-88746650 AGGGCTGTAGCCAGAGCTCCGGG - Intergenic
1058771781 9:108241057-108241079 AGGGCTGAAGCCCCAGCTGAAGG + Intergenic
1060301723 9:122378014-122378036 AGGGCTGAAGGCCCAGCTCACGG - Exonic
1060812250 9:126616332-126616354 AGGGCTGAGGCCAGAGATGTGGG + Intronic
1061934452 9:133849629-133849651 AGGCCAGAAGCCTGAGATCCAGG + Intronic
1185869692 X:3653340-3653362 AGGCTGGAAGTCCGAGATCGAGG - Intronic
1187276309 X:17819072-17819094 AAGGCCGAAGCCCTAGAGCGGGG - Intronic
1190620693 X:52284582-52284604 AGGCCTGAAGCCTGGGATCCAGG - Intergenic
1192929018 X:75785133-75785155 AAAGCTGAAGCCCGAGACCCTGG + Exonic
1194623055 X:96196725-96196747 ATGGCTGAAGCCCCACAGCGAGG - Intergenic
1195536998 X:106020255-106020277 AGGGCTGAAGTCCCAGATCAAGG - Intergenic
1198680572 X:139177696-139177718 AGGGCTGAAGCCAGGGAGCTAGG - Intronic
1200048897 X:153418032-153418054 AGGCCAGAAGTCCGAGATCCAGG - Intergenic
1200051889 X:153437188-153437210 AGGCCAGAAGTCAGAGATCGAGG - Intergenic
1200132273 X:153857125-153857147 AGGGAAGAAGCCCGAGATCAAGG + Intergenic
1201386914 Y:13451064-13451086 AGGGCTGGAGCCTGAGATAATGG - Intronic