ID: 1084331451

View in Genome Browser
Species Human (GRCh38)
Location 11:68432898-68432920
Sequence TGGCCTCCATGGTCACACGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 102}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084331441_1084331451 11 Left 1084331441 11:68432864-68432886 CCGCACTGAGGACGTGGAGCCCC 0: 1
1: 0
2: 1
3: 14
4: 168
Right 1084331451 11:68432898-68432920 TGGCCTCCATGGTCACACGTAGG 0: 1
1: 0
2: 1
3: 6
4: 102
1084331449_1084331451 -10 Left 1084331449 11:68432885-68432907 CCGAGGGGCAGGATGGCCTCCAT 0: 1
1: 0
2: 0
3: 29
4: 199
Right 1084331451 11:68432898-68432920 TGGCCTCCATGGTCACACGTAGG 0: 1
1: 0
2: 1
3: 6
4: 102
1084331439_1084331451 16 Left 1084331439 11:68432859-68432881 CCAGCCCGCACTGAGGACGTGGA 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1084331451 11:68432898-68432920 TGGCCTCCATGGTCACACGTAGG 0: 1
1: 0
2: 1
3: 6
4: 102
1084331440_1084331451 12 Left 1084331440 11:68432863-68432885 CCCGCACTGAGGACGTGGAGCCC 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1084331451 11:68432898-68432920 TGGCCTCCATGGTCACACGTAGG 0: 1
1: 0
2: 1
3: 6
4: 102
1084331435_1084331451 24 Left 1084331435 11:68432851-68432873 CCGCATGCCCAGCCCGCACTGAG 0: 1
1: 0
2: 0
3: 17
4: 244
Right 1084331451 11:68432898-68432920 TGGCCTCCATGGTCACACGTAGG 0: 1
1: 0
2: 1
3: 6
4: 102
1084331437_1084331451 17 Left 1084331437 11:68432858-68432880 CCCAGCCCGCACTGAGGACGTGG 0: 1
1: 0
2: 1
3: 4
4: 86
Right 1084331451 11:68432898-68432920 TGGCCTCCATGGTCACACGTAGG 0: 1
1: 0
2: 1
3: 6
4: 102
1084331447_1084331451 -8 Left 1084331447 11:68432883-68432905 CCCCGAGGGGCAGGATGGCCTCC 0: 1
1: 0
2: 1
3: 17
4: 431
Right 1084331451 11:68432898-68432920 TGGCCTCCATGGTCACACGTAGG 0: 1
1: 0
2: 1
3: 6
4: 102
1084331448_1084331451 -9 Left 1084331448 11:68432884-68432906 CCCGAGGGGCAGGATGGCCTCCA 0: 1
1: 0
2: 4
3: 22
4: 269
Right 1084331451 11:68432898-68432920 TGGCCTCCATGGTCACACGTAGG 0: 1
1: 0
2: 1
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084331451 Original CRISPR TGGCCTCCATGGTCACACGT AGG Intronic
900101287 1:963181-963203 TGGCCTCCATGTCCACGCGCCGG + Exonic
900341294 1:2190548-2190570 TGGCTTCCAGGGCCACACCTTGG - Intronic
900506339 1:3031480-3031502 TGGCATCCAGGGACACACGGGGG + Intergenic
901626625 1:10628628-10628650 TGGCCCCCACGGTCACCCGATGG - Intronic
901656927 1:10774708-10774730 AGGCCTACAGGGTCACACTTGGG - Intronic
907322087 1:53609830-53609852 TGGCATACATGATCACACCTAGG + Intronic
919798493 1:201336420-201336442 GGGGCACCATGGTCACAGGTTGG - Intergenic
921179439 1:212619943-212619965 TGGCTACCATTGTCACTCGTAGG + Exonic
922774666 1:228209115-228209137 GGGCCACCACGGTCACCCGTGGG - Intronic
1067477798 10:46578123-46578145 TGTCCTCTCTGGTCACACCTCGG - Intergenic
1070465911 10:76723560-76723582 TGCCTTCCATTCTCACACGTTGG + Intergenic
1070673958 10:78399127-78399149 TGGCCCCCATGGTCACTAGGAGG - Intergenic
1072662179 10:97369933-97369955 TGGACTGCACAGTCACACGTGGG + Intronic
1075511041 10:123073328-123073350 TGGCCTGCATGGGCCCACGGAGG - Intergenic
1076839355 10:133038465-133038487 TGGCCTCCAGGGAAACACTTCGG - Intergenic
1077231430 11:1459672-1459694 GGGCCTCCATCGACACACCTGGG + Intronic
1079114217 11:17630421-17630443 TGGTTCCCATGGTCACACTTTGG - Intronic
1081793736 11:45805685-45805707 AGCCCTCCATTGTCACATGTGGG - Exonic
1084331451 11:68432898-68432920 TGGCCTCCATGGTCACACGTAGG + Intronic
1086784115 11:90944423-90944445 TTTCCTCAATGGTCACATGTGGG + Intergenic
1087386416 11:97474656-97474678 TGTCCTCCATGGGCACACCTAGG + Intergenic
1091529436 12:1340069-1340091 TGGCCCCCACGGTCACACGCTGG - Intronic
1104166770 12:126239041-126239063 TGGACTCCATGGTCCCAAGGTGG + Intergenic
1105917428 13:24929460-24929482 TGGCCTCCATGGTAATAAATTGG + Intergenic
1109185711 13:59265208-59265230 TGGCCTCCATAGTAACGGGTGGG + Intergenic
1119522122 14:75294206-75294228 TGGTTTCCACGGTGACACGTAGG + Intergenic
1202863938 14_GL000225v1_random:103766-103788 GGCCCTCCATGGTGACAGGTGGG + Intergenic
1125452510 15:39823972-39823994 TGGCCTCCATTGTTAGAAGTGGG + Intronic
1127479695 15:59367399-59367421 TGGCCTCCAATGTCACATGATGG - Intronic
1128993029 15:72276299-72276321 TGGCCTCCATGGCCACTTGAAGG + Intronic
1130602508 15:85285971-85285993 TGGCCTCCATGTTCAAAGGCTGG - Intergenic
1130766380 15:86875680-86875702 TGGCCTCCATGTTCAAAGGCTGG + Intronic
1131586285 15:93697092-93697114 TAGCCTCCATGGTCATACCTGGG + Intergenic
1135323337 16:21511348-21511370 TGGGCTTCCTGGTCACAAGTGGG - Intergenic
1135870734 16:26147663-26147685 TTGCCTTCATGGTCACAAGATGG - Intergenic
1136334823 16:29604614-29604636 TGGGCTTCCTGGTCACAAGTGGG - Intergenic
1138328939 16:56197206-56197228 TGGCCCCCAGGGTCGCACGTTGG + Intronic
1140906112 16:79410787-79410809 TGCCATCTATGGTCACACGATGG - Intergenic
1142035539 16:87860432-87860454 TGGGCTTCCTGGTCACAGGTGGG - Intronic
1142693009 17:1618167-1618189 GGGGCTCCTTGGCCACACGTTGG - Intronic
1143389091 17:6549570-6549592 AGGCCTCCACAGGCACACGTGGG + Intronic
1145230405 17:21169749-21169771 TGGCCTCCAGGGGCCCACGGAGG + Intronic
1145275296 17:21425540-21425562 CAGCTTCCATGGACACACGTGGG - Intergenic
1148449947 17:47770447-47770469 TGCCCTCCATGGCCAGACCTAGG - Intergenic
1149554892 17:57566473-57566495 TGGCCCCCTGGGTCACATGTTGG + Intronic
1150501968 17:65659843-65659865 TGGCCTCCATTATCCCACATAGG - Intronic
1152482575 17:80564886-80564908 TGGCCTCCATGTTCCCACAAAGG + Intronic
1152706657 17:81847137-81847159 TGGCCTCCAATGTCAGACGCTGG + Intronic
1164146354 19:22514878-22514900 TGGCAGCCCTGGTCACACCTGGG + Intronic
1165675643 19:37719968-37719990 CGGCCTCCTTGGTAACACATGGG + Intergenic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
1167118065 19:47499582-47499604 TGGCCTCAGTGGTCACATGGTGG - Intronic
1167394915 19:49222187-49222209 TGGACTCCAAGGTCCCACGGGGG - Intergenic
1168405257 19:56107351-56107373 CGGCCTTCATGTTCCCACGTGGG - Intronic
926121898 2:10245792-10245814 TGGCCTCCGTGGTGACAGGAGGG + Intergenic
929931789 2:46262713-46262735 TGGACACCATGGTGACAGGTTGG - Intergenic
936572085 2:113625920-113625942 GGGCTTCCAAGGTCACAGGTAGG - Intergenic
937225504 2:120366537-120366559 TGCCCTCCAGGGTGACATGTGGG + Intergenic
941454266 2:165696505-165696527 TGTCCTCCATGGTCAGTCATTGG + Intergenic
944083942 2:195822025-195822047 TGGCCTCCATGGTCTGCCATGGG - Intronic
947314863 2:228845562-228845584 TGACCTCCATGGTGACAGGATGG - Intergenic
1170881286 20:20298588-20298610 TGGCCCCCATGGCCACACCAGGG + Intronic
1172765597 20:37349065-37349087 TGGCCTTCATTGTCACACAGGGG + Intronic
1179274560 21:39880232-39880254 TGACCTCCATGGTCAGGCTTGGG - Intronic
1182300230 22:29333071-29333093 TGGCCTCCAGGGTCACATGAGGG + Intronic
1183394148 22:37561758-37561780 TGGCCTCCAGGATGAGACGTGGG + Intronic
1185428106 22:50784960-50784982 GGGCTTCCAAGGTCACAGGTAGG + Intergenic
949470338 3:4389288-4389310 TGGCCTTCATGGTCACCAATGGG + Intronic
950575365 3:13829005-13829027 CGGCCTCCGTGGTCAGAGGTAGG - Intronic
950943366 3:16917537-16917559 TGGCTTCCATACTCACATGTTGG + Intronic
954386511 3:50246701-50246723 TGGGCTCCGTGGGAACACGTGGG - Intronic
954575530 3:51674000-51674022 TGGCAGCCCTGGTCACACCTGGG - Intronic
956884345 3:73544020-73544042 TGGCCACCATGGTGAAACCTCGG + Intronic
960594139 3:119392605-119392627 AGGCCTCCATGGTGACCCCTGGG + Intronic
961556900 3:127702087-127702109 TGGCTTCCAAGGTCACACTGAGG + Intronic
968561253 4:1283950-1283972 TGGCCTCCCTGCTCCCAGGTGGG - Intergenic
969977719 4:11121578-11121600 TGGACTCCAAGGTCAGACATTGG - Intergenic
973833974 4:54790756-54790778 TTAGCTCCATGGTCACACTTAGG - Intergenic
978404337 4:108363620-108363642 TGGCTTCCATGGTGAGAAGTAGG + Intergenic
978704505 4:111690697-111690719 TGGCCTCCATGGAAACACAGCGG - Intergenic
986356672 5:6935458-6935480 TTGCTTCCATGGTCATACTTGGG + Intergenic
992869702 5:80993896-80993918 TGGCCTCCAGGGGCACAGATGGG + Intronic
994114189 5:96043568-96043590 CTGCCTCCCTGGTCACAAGTTGG + Intergenic
1003195059 6:3906849-3906871 TGGCCTCCATGGTGGCACGTGGG - Intergenic
1004756002 6:18611058-18611080 TGCCTTCCATGGCCACAGGTGGG - Intergenic
1006830567 6:36965390-36965412 TGTCCTCCTTGGTTACAGGTCGG - Intergenic
1009599987 6:65786829-65786851 TGGCTTCCATGGTCACTCCATGG + Intergenic
1014199200 6:118589987-118590009 TGGCCTCAATAGTCACATCTGGG - Intronic
1017057675 6:150452769-150452791 TGGCCCACACGGTCACACATGGG - Intergenic
1024981163 7:55158806-55158828 TGGCCTCCCTGGGCATATGTGGG + Intronic
1025116154 7:56260246-56260268 TGGCCTCCATGGAAACATGGTGG - Intergenic
1031790943 7:126103596-126103618 TGGCCTCCAAGGTCCCACAAAGG - Intergenic
1034218683 7:149427665-149427687 GGTCCTCCAAGGTCACAGGTGGG - Intergenic
1035903284 8:3480733-3480755 TGGCCTCCATGATCCCAAATGGG - Intronic
1037939550 8:22941402-22941424 TGCTCTCCGTGGTCAAACGTTGG - Intronic
1040293591 8:46137886-46137908 TAGCCTCCCTGGAAACACGTGGG + Intergenic
1043686914 8:83098151-83098173 TTGCCTCCTTGGTTACAGGTAGG - Intergenic
1047760741 8:127952263-127952285 TGGCCTCCCTGGGCACATGGAGG - Intergenic
1049053319 8:140215911-140215933 TGGCCTCCAAGGGCAGACGGGGG + Intronic
1049337019 8:142092048-142092070 TGGCCTCCCTGGGCACTCATGGG - Intergenic
1059476392 9:114551207-114551229 TGGCCTCCCTGGTCCTCCGTTGG - Intergenic
1060121513 9:120994833-120994855 TGGCCTTGATGTTCACACCTAGG + Intronic
1061559991 9:131395678-131395700 TGGCATCCATGGGCACAGTTTGG - Intronic
1203740381 Un_GL000216v2:172250-172272 GGCCCTCCATGGTGACAGGTGGG - Intergenic
1185830508 X:3297925-3297947 AGGCTTCCAAGGTCATACGTTGG + Intergenic
1189917098 X:45866239-45866261 TAGCCACCATGGTCACTCGTTGG + Intergenic
1195677161 X:107515423-107515445 TGGCCTCCATGGTCATCTCTCGG - Intergenic
1199327714 X:146519992-146520014 TGGCCTCCATGGTTTCAGATGGG - Intergenic
1200815061 Y:7522575-7522597 TGGCCTCCATGATCCCACAAAGG - Intergenic
1200950394 Y:8893200-8893222 TAGCTTCCATAGTCACACCTTGG + Intergenic